Labshake search
Citations for GenScript :
451 - 500 of 1011 citations for Rabbit Anti Borrelia burgdorferi sensu stricto B31 CRASP 2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... anti-His6 (Genscript), and anti-σA (gift of David Rudner ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding SARS-CoV-2 and other coronavirus S-2P (Genscript) were transiently transfected in FreeStyle 293-F cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Codon-optimized spike of SARS-CoV-2 was purchased from GenScript and subcloned to pcDNA3.1 ...
-
bioRxiv - Immunology 2021Quote: ... SARS CoV-2 Nucleocapsid human chimeric mAb (GenScript, Cat # A02039-100), or in-house antibodies to ORF3a and ORF8 served as positive controls ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein-crud (RP30020, GenScript Biotecn Corp). A ten amino acid overlapping peptide mixture pool was prepared ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 spike gene (Wuhan) was synthesized by Genscript for Dr ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 N and S1 proteins were obtained from Genscript and Sino Biological.
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 2 mL of nickel resin (GenScript) at RT for 20 minutes and washed once with lysis buffer and another three times with wash buffer (20 mM Tris-Cl pH8.8 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transferred membranes were incubated with the following primary antibodies overnight at 4°C: DUXBL (1:1000, Custom antibody, GenScript), ZSCAN4C (1:500 ...
-
bioRxiv - Microbiology 2019Quote: ... the dissected thrips tissues that were only incubated with secondary antibody (without adding primary antibody) and the tissues incubated with each pre-immune mouse antiserum (GenScript) were used as negative controls ...
-
bioRxiv - Immunology 2023Quote: The antibody heavy chain genes of matured AIIMS-P01 lineage antibody was synthesized after codon-optimization for mammalian expression from Genscript, Inc ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were blocked and incubated with primary antibodies and secondary antibodies using eZwest Lite Automated Western Device (GenScript Biotech, China). Membranes were then incubated with Omni-ECL™Femto Light Chemiluminescence Kit (Epizyme ...
-
bioRxiv - Developmental Biology 2021Quote: Polyclonal antibodies were generated by Genscript (https://www.genscript.com/). The epitopes used for each immunization are listed below.
-
bioRxiv - Immunology 2021Quote: Generation of antibody expression vectors was outsourced (Genscript). The Ig VH and VL sequences were cloned into a pcDNA3.4 expression vector containing human IgG1 constant regions ...
-
bioRxiv - Neuroscience 2019Quote: The polyclonal DIPγ antibody was generated by Genscript in guinea pigs using the following epitope ...
-
bioRxiv - Bioengineering 2020Quote: ... HRP-conjugated secondary antibodies against His-tag (Genscript) were diluted 1:5,000-10,000 and incubated with the well for 1 hr at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Genes of bispecific antibodies were synthesized by Genscript. The authentic Omicron (B.1.1.529 ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse α-His antibody (1:1000, Genscript A00186) in TBST buffer with 0.5% BSA and goat α-mouse IgG (H+L ...
-
bioRxiv - Immunology 2019Quote: Recombinant antibodies were cloned and expressed by Genscript. Briefly ...
-
bioRxiv - Developmental Biology 2021Quote: ... The polyclonal NvINSM1 antibody was raised by GenScript in rabbit against amino acids 3 – 170 of NvINSM1 expressed in and purified from E.coli ...
-
bioRxiv - Biochemistry 2021Quote: Polyclonal antibodies against PTP7 were generated by Genscript. Briefly ...
-
bioRxiv - Microbiology 2020Quote: Recombinant antibodies were cloned and produced by Genscript. Specifically ...
-
bioRxiv - Microbiology 2021Quote: ... neutralizing monoclonal antibody (GenScript®, clone ID: 6D11F2) was also used ...
-
bioRxiv - Immunology 2020Quote: ... or corresponding species-appropriate IgG control antibody (GenScript), conjugated to Protein A Dynabeads (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant antibody was cloned and produced by Genscript. Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... THE V5 Tag Antibody (1:2000, GenScript Biotech) was used as primary antibody for samples and mouse anti-clathrin heavy chain clone 23 (1:2,000 ...
-
bioRxiv - Developmental Biology 2023Quote: Polyclonal antibodies were generated by Genscript (https://www.genscript.com/). The protein sequences used for each immunization were as follows ...
-
bioRxiv - Developmental Biology 2022Quote: ... immunization and antibody purification were performed by Genscript Biotech Corporation (Piscataway ...
-
bioRxiv - Bioengineering 2023Quote: ... GenCRISPRLL SaCas9 Antibody 26H10 (GenScript, #A01952, Piscataway, NJ), and Anti-Adeno-associated Virus 9 Antibody clone HL2374 (Millipore Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... Antagonist peptide 1 (SCSLFTCQNGIV) and 2 (SCSLFTCQNGGGWF) were chemically synthesized by Genscript. Anti-Mouse-IgG (H&L ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant SARS-CoV-2-RBD (T80302) was obtained from Genscript (NanJing, China). Antagonist peptide 1 (SCSLFTCQNGIV ...
-
bioRxiv - Systems Biology 2019Quote: ... half of the cells were stimulated with erythropoietin (2 ng/mL; GenScript) 24 hours after transfection ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2-RBD-his protein was purchased from GenScript (GenScript, Nanjing), and GPC5-his protein was purchased from R&D (Minneapolis ...
-
bioRxiv - Microbiology 2020Quote: ... and SARS-CoV-2 spike protein (ECD, His & Flag Tag) (GenScript Z03481). Proteins were biotinylated using EZ-Link™ Sulfo-NHS-Biotin ...
-
bioRxiv - Immunology 2021Quote: ... and B.1.617.2+ SARS-CoV-2 RBD construct were synthesized by GenScript into pCMVR with an N-terminal mu-phosphatase signal peptide ...
-
bioRxiv - Immunology 2022Quote: ... 2 µg/ml MHC-I binding SIINFEKL peptide (ovalbumin 257-264, GenScript), or 2 µg/ml ISQAVHAAHAEINEAGR MHC-II binding peptide (ovalbumin 323-339 ...
-
bioRxiv - Neuroscience 2023Quote: The riboprobes were synthetized from 2 clones that were purchased from Genscript or obtained by BBSRC ChickEST Database (Boardman et al. ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit (GenScript, L00847-A) was used according to the manufacturer’s instructions as follows ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-SUMO (GenScript: A01693) and anti-GST (Abmart ...
-
bioRxiv - Biochemistry 2022Quote: ... anti-His tag (Genscript) or anti-FLAG (Genscript ...
-
bioRxiv - Biochemistry 2022Quote: ... or anti-FLAG (Genscript) antibodies ...
-
African Swine Fever Virus CD2v protein promotes β-Interferon expression and apoptosis in swine cellsbioRxiv - Microbiology 2020Quote: ... anti-Flag (A00187; Genscript) or anti-phosphorylated NF-κB (S536 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-V5 from GenScript and anti-GFP from Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2021Quote: ... was used as an immunogen in New Zealand rabbits and custom-generated by Genscript Inc ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was run on separate 12% SDS–polyacrylamide gel and probed using βarr antibody and HRP-coupled protein L antibody (dilution-1:2,000; GenScript; cat. No. M00098) by western blotting ...