Labshake search
Citations for GenScript :
701 - 750 of 949 citations for RNA Binding Motif Protein 45 RBM45 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... gene was codon-optimized and cloned into the p423_GAL1 yeast expression vector as an N-terminal Flag (DYKDDDDK) and C-terminal deca-histidine (10X His) tagged fusion protein (GenScript) (Supplementary Fig ...
-
bioRxiv - Molecular Biology 2021Quote: CHAMP1 and POGZ guide RNA sequences were cloned into the pSpCas9 BB-2A-GFP (PX458) vector (GenScript). U2OS and RPE1p53-/- cells were transfected with Cas9-gRNA plasmids ...
-
bioRxiv - Immunology 2021Quote: ... Specific anti-CoV immunoreactivity was detected using a SARS-CoV-2 nucleoprotein antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Biochemistry 2019Quote: ... we designed and purchased an anti-horse-SLN polyclonal antibody from Genscript (pAb GS3379). The immunogen was a 6-residue N-terminal peptide of horse SLN (Q1MEWRRE6C) ...
-
bioRxiv - Developmental Biology 2020Quote: ... A primary antibody specifically for zebrafish was used to detect Esco2 (1:1000, GenScript). Alexa 546 anti-rabbit (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... EsxA and SodA were generated for this study (Customer’s Antigen Polyclonal Antibody Package, Genscript). C-terminally his6-tagged SiEsaA41-871 ...
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Microbiology 2021Quote: ... Western blot using a mouse anti-Histidine tag monoclonal Antibody (Genscript Cat. No. A00186) was used to confirm purity of the purified protein (Figure-1S) ...
-
bioRxiv - Microbiology 2020Quote: ... or by an HRP-linked rabbit anti-camelid VHH monoclonal antibody (A01861-200, GenScript). After washing 50 µL of TMB substrate (Tetramethylbenzidine ...
-
bioRxiv - Immunology 2022Quote: ... The polypeptide antibody against shrimp NLRP3 (aa29-42) was prepared by GenScript (Nanjing, China).
-
bioRxiv - Microbiology 2022Quote: ... which were coated in anti-HIS antibody [Biotin] (GenScript A00613, mouse IgG1k clone 6G2A9) at 2.5 μg/mL ...
-
bioRxiv - Biophysics 2022Quote: ... Biotin-labeled mouse monoclonal antibody against the Strep-tagII (“NWSHPQFEK”) was purchased from Genscript (GenScript Cat# A01737 ...
-
bioRxiv - Immunology 2022Quote: ... the standard curve was run using an IgG1 SARS-CoV-2 neutralizing antibody (GenScript) for full quantification ...
-
bioRxiv - Cell Biology 2022Quote: ... Slc37a2 peptide antibodies were produced using the PolyExpressTM service by GenScript (New Jersey, USA).
-
bioRxiv - Microbiology 2020Quote: ... GrgA and mutants were detected using a monoclonal anti-His antibody (Genscript, Cat. A00186) and a mouse anti-GrgA antibody (35).
-
bioRxiv - Immunology 2021Quote: Competitive inhibition ELISA was performed using SARS-CoV-2 neutralization antibody detection kit (Genscript). The kit detects circulating neutralizing antibodies against SARS-CoV-2 that block the interaction between the receptor binding domains of the viral spike glycoprotein (RBD ...
-
bioRxiv - Cell Biology 2021Quote: ... Western blot analysis was performed using THETM DYKDDDDK Tag Antibody [HRP-conjugated] (A01428, GenScript) and Monoclonal Anti-polyHistidine−Peroxidase (A7058 ...
-
bioRxiv - Microbiology 2021Quote: ... 0.2% Tween-20) for 30 min and probed with CaBcy1 rabbit polyclonal antibody (GenScript) or CaTpk2 rabbit polyclonal antibody (GenScript) ...
-
bioRxiv - Biochemistry 2022Quote: ... The following phospho-specific antibodies were used: pS384-RPA70 (monoclonal, custom generated by Genscript), pS10-Histone H3 (Cell Signaling ...
-
bioRxiv - Immunology 2022Quote: ... the four genes for each multispecific antibody were synthesized using human preferred codons (GenScript) and cloned into eukaryotic expression vectors ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were probed with an anti-EsxA1 rabbit polyclonal antibody (0.5 μg/ml; GenScript) in the above LI-COR blocking buffer overnight at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... The variable regions of heavy and light chains for each antibody were synthesized (GenScript), cloned into gWiz or pCDNA3.4 vector ...
-
bioRxiv - Microbiology 2022Quote: ... The following antibodies were used: rabbit anti-GST (GenScript, A00097, 1:2000 for WB), rabbit anti-Flag (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... anti-VHH monoRab antibody conjugated to horse-radish peroxidase (Genscript, catalogue number A01861-200) was added at a concentration of 0.2 µg/mL (0.1 mL per well ...
-
bioRxiv - Immunology 2023Quote: ... TotA was used as immunogen to produce rabbit anti-TotA antibody (made by GenScript).
-
bioRxiv - Immunology 2023Quote: ... A CM5 chip with covalently immobilized anti-Avi polyclonal antibody (GenScript, Cat #: A00674-40) was used for surface capture of His-Avi tag containing RBDs ...
-
bioRxiv - Immunology 2023Quote: ... Transduced cells were detected by eGFP expression or by an anti-VHH antibody (Genscript) directed against the nanobody constituting the extracellular domain of the CAR and analyzed by flow cytometry.
-
bioRxiv - Cell Biology 2023Quote: ... membranes were incubated with either anti-FLAG antibody conjugated to iFluor 488 (GenScript A01809) at 1:2,000 dilution ...
-
bioRxiv - Immunology 2024Quote: ... and incubated with FITC conjugated anti-FLAG mouse monoclonal antibody (GenScript, Cat. No. A01632) at a concentration of 2 µg per million cells for 1 hr at 37 C in the dark ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein of the extracellular domain of human ACE2 (aa 1-740) fused to Fc (ACE2-Fc, Genscript, Nanjing, China) was coated on 96-well microtiter plate (50 ng/well ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rosetta synaptobrevin a codon-optimised nucleotide sequence encoding the soluble portion of the protein [Syb (1-75)] was prepared by gene synthesis (Genscript, USA): GAGGCGAACCGTACCGGTGACTACCGTCTGCAGGAAGCGCAGCGTCAAGTGGGCGAAGTT CAAAACGTGATGCGTGATAACCTGACCAAGGTTATCGAGCGTGGTGAAAAACTGGACGATC TGGACGCGAAGGCGGAAGATCTGGAGGCGGAGGGTCAGCGTTTCCAAAACCGTGCGGGCC GTCTGCGTCGTCAGATGTGGTGGCAAAACAAACGTAACCAGTAA
-
bioRxiv - Developmental Biology 2022Quote: ... The protein was eluted using elution buffer (50mM Tris-HCL,7.4, 100mM NaCl, 1mM EGTA, Flag peptide (GenScript, 300 μg/ml). The isolated proteins were then prepared for mass spectrometry using an in-solution protein digestion kit (Thermo Scientific) ...
-
bioRxiv - Bioengineering 2021Quote: Purified RfxCas13d proteins and synthetic crRNAs were mixed (unless otherwise indicated) at 2:1 molar ratio in Buffer 1 (GenScript SC1841) or Buffer 22 (25mM Tris pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... FLAG-tagged proteins were released from the resin by incubation with buffer supplemented with 50 mM FLAG peptide (Genscript, Piscataway, NJ) for 30 min.
-
The E3 ubiquitin-protein ligase MDM2 is a novel interactor of the von Hippel-Lindau tumor suppressorbioRxiv - Biochemistry 2020Quote: ... Genes encoding the human MDM2 and pVHL30 proteins were obtained from commercial plasmid provided by GenScript (GenEZ plasmid OHu28568 and OHu23297) and cDNA transferred into pGBKT7 and pGADT7 plasmids (Clontech ...
-
bioRxiv - Biochemistry 2021Quote: ... cDNAs that code mature proteins of human mitochondrial ECSIT (UniProtKB-Q9BQ95) and NDUFAF1 (UniProtKB-Q9Y375) were purchased from GenScript (Piscataway, USA) as codon-optimized for E ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...
-
bioRxiv - Microbiology 2020Quote: ... Target proteins were obtained with purity >85% and endotoxin level <2 EU/mg (LAL Endotoxin Assay Kit, GenScript, Cat. No. L00350). In addition ...
-
bioRxiv - Cell Biology 2020Quote: ... and for generation of EGFP-C2-Arp3B plasmid, the mRNA transcript variant 1 encoding murine actin-related protein 3B (Actr3b) (Jay et al., 2000) was synthesized (GenScript Biotech) and cloned into pEGFP-C2 vector (Clontech).
-
bioRxiv - Cell Biology 2022Quote: ... 20-50 μg of protein lysate of each sample was loaded and separated on 4-12% Bis-Tris gels (Thermo Fisher or GenScript) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight with 250 ng/well of purified recombinant Coronavirus proteins and 500 ng/well of a SARS-CoV-2 fusion sequence-containing peptide (KRSFIEDLLFNKVTLADAGFIK, GenScript Biotech). After washings with 0.05% Tween 20-PBS (washing buffer) ...
-
bioRxiv - Biochemistry 2022Quote: Sequences encoding the 3CL-pro and RBD proteins were codon optimized for expression in Escherichia coli and cloned into the pET-28a(+) vector (Genscript Biotech). The chimeric protein 3CLpro-RBD was produced by generating a gene construct that linked the 3CL-pro and RBD genes by a bridge sequence that encoded for glycine-proline triple repeat (GPGPGP ...
-
bioRxiv - Molecular Biology 2020Quote: ... vector containing DENV2C protein gene sequence with N-terminal His tag and Tobacco Etch Virus (TEV) digestion site was purchased from GenScript (China). Recombinant capsid protein from DENV2 NGC strain was expressed in Escherichia coli BL21 strain ...
-
bioRxiv - Microbiology 2021Quote: ... active protein fractions were further separated through sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; 4%–20% Bis-Tris Gel; GenScript, USA). Proteins in the gel slices were eluted in HEPES-K+ buffer (50 mM ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...
-
bioRxiv - Microbiology 2020Quote: ... class C-like β-lactamase protein (gi|919167542) and the Elizabethkingia GOB-13 (AY647250) were synthesized by GenScript (Piscataway, NJ, USA) and optimized for protein expression in Escherichia coli in the pET24a(+ ...
-
bioRxiv - Molecular Biology 2022Quote: Equal sample concentrations (100 μg of total protein per well) were resolved in 4%–20% electrophoresis gradient gels (Genscript, Cat. M00656) and transferred onto polyvinylidene difluoride (PVDF ...
-
bioRxiv - Plant Biology 2022Quote: ... Sequences starting after the residue corresponding to butelase-1-L26 or after the signal peptide predicted using SignalP5.0 were cloned into the pET28a(+) vector at Ndel/Xhol restriction sites to generate a His6-fusion protein construct (Genscript, USA). Point mutations were generated using a Q5 mutagenesis kit (New England Biolabs ...
-
Novel mRNA vaccines encoding Monkeypox virus M1R and A35R protect mice from a lethal virus challengebioRxiv - Immunology 2022Quote: M1R and A35R protein sequences from MPXV strain Zaire79 were used to reversely translate to their coding sequences by GenSmart™ Codon Optimization (GenScript). The A35R extracellular domain was fused with M1R by a peptide linker was also synthesized ...