Labshake search
Citations for GenScript :
1 - 50 of 247 citations for QuantiFluo Caspase 3 Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Microbiology 2022Quote: The ToxinSensor Chromogenic LAL Endotoxin Assay kit (GenScript) was used to determine endotoxin units/mL of culture ...
-
bioRxiv - Bioengineering 2020Quote: ... and measured by ToxinSensor Chromogenic LAL Endotoxin Assay Kit (Genscript). The purified Nbs were further sterilized by passing a 0.2 μm filter (Millex ...
-
bioRxiv - Immunology 2020Quote: For the surrogate neutralization assay the cPass kit from GenScript was used (Cat ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... ToxinSensor Gel Clot Endotoxin Assay Kits were purchased from GenScript. VacciGrade LPS was purchased from InvivoGen.
-
bioRxiv - Cell Biology 2024Quote: pcDNA3.1 vectors expressing human caspase-4 and human IL-18 were purchased from Genscript. Mutagenesis primers were designed using Aligent Quik change primer design ...
-
bioRxiv - Microbiology 2020Quote: ... The remnant endotoxin was identified with ToxinSensorTM Chromogenic LAL Endotoxin Assay Kit (Genscript) and no more than 0.1 EU/mL of endotoxin was detected.
-
bioRxiv - Cell Biology 2019Quote: ... quantified using a chromogenic limulus amebocyte lysate endotoxin assay kit (GenScript, Piscataway, NJ), were significantly below those necessary for activation of TLR4 (typically <0.05 ng/ml).
-
bioRxiv - Immunology 2023Quote: ... Endotoxin levels were measured using the ToxinSensor Chromogenic LAL Endotoxin Assay Kit (Genscript), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... a single synthetic gene containing the aforementioned individual caspase activity sensors was designed (GenScript, Piscataway, USA). Briefly ...
-
bioRxiv - Genetics 2021Quote: ... and contaminants were removed by Toxin Sensor Chromogenic LAL Endotoxin Assay Kit (GenScript, L00350). Purified proteins were concentrated and filtered using Amicon ultra filter units – 30k NMWL (MilliporeSigma ...
-
bioRxiv - Immunology 2020Quote: ... Endotoxin concentration was determined using the ToxinSensorTM Chromogenic LAL Endotoxin Assay Kit (Genscript, NJ). All protein used for immunization had final endotoxin levels below 10 EU/ml ...
-
bioRxiv - Bioengineering 2019Quote: Endotoxin amounts were tested using the ToxinSensor chromogenic LAL endotoxin assay kit (GenScript, Piscataway, NJ) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... and checked for endotoxins levels using the ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript).
-
bioRxiv - Bioengineering 2020Quote: ... Polymers were evaluated for endotoxin using a Chromogenic LAL Endotoxin Assay Kit (GenScript, Nanjing, China).
-
bioRxiv - Immunology 2021Quote: Pseudo-neutralization assays were performed on hamster serum using the cPassTM Neutralization Antibody Detection kit (GenScript).
-
bioRxiv - Immunology 2019Quote: ... omentum culture supernatants and peritoneal lavage fluid using the ToxinSensorTM Chromogenic LAL Endotoxin Assay Kit (GenScript) following manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA ...
-
bioRxiv - Microbiology 2021Quote: ... and the endotoxin level was measured using the ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (Genscript) to make sure <1 EU/ml ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA (4) ...
-
bioRxiv - Biophysics 2023Quote: Endotoxin levels of purified samples were determined using a ToxinSensor chromogenic LAL endotoxin assay kit (GenScript) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... and then tested post-treatment for endotoxin levels using the ToxinSensorTM Chromogenic LAL Endotoxin Assay Kit (Genscript). Endotoxin levels of tau were < 0.1 EU/mL at working concentrations ...
-
bioRxiv - Neuroscience 2022Quote: ... The caspase activity reporter transgene (Figure 1A, annotated sequence available upon request) was synthesized and inserted into pCAGEN by GenScript. Pronuclear microinjection of the transgene into C57BL/6NHsd one-cell embryos was performed by Duke’s Transgenic Mouse Facility ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The RBD-ACE2 assay was performed using SARS-CoV-2 sVNT ready to use kit sold by Genscript Inc ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Microbiology 2020Quote: ... Serum LPS concentrations were measured with a ToxinSensor Chromogenic Limulus Amebocyte Lysate (LAL) Endotoxin Assay Kit (GenScript, Piscataway, NJ), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and endotoxin contamination was tested using a ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, Piscataway, NJ, USA; L00350). All cultures were maintained at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: RBD-ACE2 binding competition assay was developed using the SARS-CoV-2 surrogate virus neutralization test kit (Genscript, NJ). First a 5-fold dilution series of RBD variant starting at 10 μM was prepared in sample dilution buffer in duplicate ...
-
bioRxiv - Cell Biology 2022Quote: ... Endotoxin levels in all preparations were measured using ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, Piscataway, NJ, USA) and were less than 0.05 EU/ml.
-
bioRxiv - Immunology 2022Quote: The concentration of endotoxin in CXCL4 stock solutions was measured by Chromogenic LAL Endotoxin Assay Kit (GenScript, cat. No: L00350C) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... followed with the measurement of the level of endotoxin by ToxinSensor Chromogenic LAL Endotoxin Assay Kit (GenScript Biotech Corp., USA). The recombinant α-syn solution was aliquoted before fibrillization and stored at −80°C until use ...
-
bioRxiv - Biochemistry 2023Quote: Remaining samples of sera from corresponding administration routes along with prebleed samples were pooled and passed through a protein A column and the recovered IgGs used in SARS-CoV-2 surrogate virus neutralisation assays (sVNT) 38 using a commercial kit (GenScript).
-
bioRxiv - Bioengineering 2024Quote: ... the endotoxin levels in OVA-ZE and pZR-ELP were quantified by ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript). OVA-ZE and pZR-ELP with low endotoxin levels and endotoxin free water and PBS were used to prepare OVA protein vesicles for in vitro and in vivo studies ...
-
bioRxiv - Immunology 2024Quote: The concentration of endotoxin in CXCL4 stock solutions was measured by Chromogenic LAL Endotoxin Assay Kit (GenScript, cat. No: L00350C) according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Microbiology 2020Quote: ... Target proteins were obtained with purity >85% and endotoxin level <2 EU/mg (LAL Endotoxin Assay Kit, GenScript, Cat. No. L00350). In addition ...
-
bioRxiv - Cell Biology 2022Quote: ... All proteins were tested for size distribution and purity by gel electrophoresis (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and were confirmed for low endotoxin using ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (Genscript). Unfractionated heparin (UFH ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Molecular Biology 2021Quote: The surrogate virus neutralization test (sVNT) assay was performed using the SARS-CoV-2 surrogate virus neutralization test kit (GenScript, NJ, USA). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Cell Biology 2020Quote: The endotoxin level of FHL-1 recombinant protein preparations was measured using the Toxin Sensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, NJ, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: Recombinant proteins and Ov-ES products were evaluated for the presence of lipopolysaccharide (LPS) using a chromogenic LAL endotoxin assay kit (GenScript, Piscataway, NJ, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...