Labshake search
Citations for GenScript :
51 - 100 of 152 citations for QuantiChrom Hyaluronidase Inhibitor Screening Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... Luciferase activity was analyzed with a Luciferase Assay System (GenScript, Cat: #L00877C). The relative luminous unit (RLU ...
-
bioRxiv - Cell Biology 2024Quote: FN fibril inhibitor experiments were performed by treating myofibroblasts with 500nM FUD (GenScript, #SC6004PF) or 500nM III-11C (GenScript ...
-
bioRxiv - Bioengineering 2022Quote: ... Peptides for zinpyr-1 competition binding assay were synthesized by GenScript (Piscataway, NJ). Reagents for making competent E.coli cells were obtained from Zymo Research (Irvine ...
-
bioRxiv - Cell Biology 2019Quote: ... Phospho-peptides conjugated to biotin for ELISA assay were synthesized by GenScript (Hong Kong). Antibodies against the IR β-subunit (sc-57342 ...
-
bioRxiv - Immunology 2021Quote: ... All Neutralization assays were performed with the surrogate virus neutralization test (sVNT) (GenScript, USA), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Minimal epitopes used in in vitro proliferation assays were ordered from Genscript (≥ 95% pure).
-
bioRxiv - Immunology 2022Quote: ... The following peptides were used for T cell stimulation in ICS assays: Trp1 (NTPQFENL, GenScript), Trp2 (SVYDFFVWL ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies for assay of transfected cells were goat polyclonal anti-HA (1:500, GenScript), and mouse monoclonal anti-FLAG (1:500 ...
-
bioRxiv - Cell Biology 2020Quote: ... 10% glycerol) with protease inhibitors and NEM containing 30 μL 1:1 anti FLAG Affinity Gel (Genscript). S100 supernatant was added directly to 600 μL of basic lysis buffer with protease inhibitors and NEM containing 30 μL 1:1 anti FLAG Affinity Gel (Genscript) ...
-
bioRxiv - Biochemistry 2020Quote: Tubulin-kinesin-13 binding assay was carried out via immunoprecipitation using Ni-charged MagBeads (GenScript, NJ), to pull down Histidine-tagged kinesin-13 proteins ...
-
bioRxiv - Developmental Biology 2021Quote: ... The α8β1 peptide inhibitor following the 23-mer sequence PRGDVFIPRQPTNDLFEIFEIER (Sato et al., 2009) was commercially generated (Genscript) and used at a 10 μM working concentration ...
-
bioRxiv - Biophysics 2020Quote: ... Inhibitors included cyclosporin A (CsA, 5 μM), hexacarboxybenzene (HCB, 10 μM) and CPSF6 peptide (100 μM, PVLFPGQPFGQPPLG, Genscript).
-
bioRxiv - Physiology 2019Quote: ... and absence of endotoxin (<0.25Eu/ml) was confirmed via the LAL gel-clot assay (GenScript, Piscataway, NJ).
-
bioRxiv - Biochemistry 2023Quote: The pull-down assays were executed using 25 μL of streptavidin-coated magnetic beads (Magbeads streptavidine, Genscript) loaded with 1 nmol of the biotinylated bait-peptides of interest ...
-
bioRxiv - Immunology 2021Quote: ... All neutralization assays performed with the surrogate Virus Neutralization Test (sVNT) (cat. n° L00847, GenScript, Piscataway, NJ, USA) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Cell Biology 2020Quote: ... S100 supernatant was added directly to 600 μL of basic lysis buffer with protease inhibitors and NEM containing 30 μL 1:1 anti FLAG Affinity Gel (Genscript). All samples were incubated overnight at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... Toxin preparations were tested for lipopolysaccharide (LPS) contamination with the Toxin Sensor Chromogenic LAL Endotoxin Assay following the manufacturer’s instructions (GenScript). SEC preparations had < 0.02 ng of LPS per 20 µg of SEC+ ...
-
bioRxiv - Immunology 2023Quote: Determination of IL10-rs3024496 and IRF3-rs2304204 as functional SNPs was achieved using luciferase assay constructs ordered from GenScript. For IL10-rs3024496 ...
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Plant Biology 2019Quote: ... HIS-TAN1 and HIS-TAN1-GFP concentrations were checked with a BCA protein assay (Genscript Corp Piscataway, New Jersey USA). After refolding ...
-
bioRxiv - Biochemistry 2021Quote: ... The H4 substrate peptide used in the assay corresponds to the first 19 residues of human H4 (NH2-SGRGKGGKGLGKGGAKRHR-COOH; GenScript). In the assay ...
-
bioRxiv - Biochemistry 2022Quote: The N-terminal peptides of ParBpSM (residues 1-27) and ParBP1 (residues 1-30) used in the ATPase assays were synthesized by GenScript. The sequence of ParBpSM1-27 and its variant ParBpSM1-27 K10A were NH2-MIVGNLGAQKAKRNDTPISAKKDIMGD-CO2H (≥97 % purity ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Mpro inhibition assay was performed using the FRET-based fluorescent peptide substrate DABCYL-KTSAVLQ↓SGFRKM-E(EDANS)-NH2 (purchased from Genscript). The assay was standardized with enzyme concentration of 140 nM and 30 µM of fluorescent substrate in Mpro assay buffer containing (20 mM Tris pH 7.3 ...
-
bioRxiv - Microbiology 2021Quote: ... a panel of gH/gL and EphA2 variants to be tested in biophysical assays was ordered as synthetic genes (GenScript) cloned in pcDNA3.1 (+ ...
-
bioRxiv - Cell Biology 2023Quote: All peptides used for binding assays (Data S1) were synthesized with a N-terminal 5-carboxyfluorescien (5-FAM) at >85% purity (GenScript); peptides used for competition studies did not have 5-FAM ...
-
bioRxiv - Microbiology 2023Quote: ... Total protein was quantified using a BCA assay and 50 μg of each sample was prepared for loading onto 12% precast PAGE gels (GenScript). Wet transfers were performed onto 0.45 uM pore-sized PVDF membranes (Immobilon) ...
-
bioRxiv - Biophysics 2022Quote: The fluorescence-based binding assay employed chemically synthesized unlabeled RNA constructs (wt and mutants) prepared in-house and a peptide mimic (Genscript) of the Tat RNA binding domain N-AAARKKRRQRRR-C containing the arginine rich motif (ARM) ...
-
bioRxiv - Immunology 2021Quote: Antibodies inhibiting virus binding to host cell was measured using a commercial RBD-human angiotensin-converting enzyme 2 (hACE2) binding inhibition assay called cPASS™ (GenScript). As per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: The transcription template for the BoxB tethered assay is a derivative of our previously described template and was purchased from GenScript (35). The 5′ UTR was replaced with one of two 5′ UTR sequences possessing varying degrees of secondary structure:
-
bioRxiv - Microbiology 2023Quote: ... Fusion proteins were generated for the assay by cloning chlamydial DNA sequences encoding CPAF into a pET30a vector (constructed by Genscript Biotech), resulting in fusion proteins with a hexahistidine (His6 ...
-
bioRxiv - Genomics 2023Quote: ... with CloneEZ PCR Cloning Kit (GenScript #L00339). The pLenti-GIII-EF1α-CBX3-Flag-HA ...
-
bioRxiv - Immunology 2023Quote: ... the commercialized ELISA kit (Genscript, Cat#L00871) was used ...
-
bioRxiv - Immunology 2021Quote: SARS-CoV-2-specific T cell responses in rhesus macaque PBMCs were assessed by an IFN-γ ELISPOT assay using recombinant SARS-CoV-2 S1 protein (GenScript, Nanjing, China). Ninety-six-well plates (Millipore ...
-
bioRxiv - Pathology 2022Quote: ... bat sera were screened at a 1:10 dilution using a competitive enzyme linked immunosorbent assay (SARS-CoV-2 sVNT, GenScript, Piscataway, New Jersey) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... a toxin Eraser endotoxin removal kit (#L00338, Genscript) with a high efficiency endotoxin removal resin was employed ...
-
bioRxiv - Neuroscience 2023Quote: ... using the High-Affinity Antibody Purification Kit (L00404, GenScript) following the manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... endotoxin was removed with the ToxinEraser™ Endotoxin Removal Kit (Genscript), and the endotoxin level was measured using the ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (Genscript ...
-
bioRxiv - Microbiology 2020Quote: ... or with the ONE-HOUR Western™ Standard Kit (Genscript, China).
-
bioRxiv - Immunology 2020Quote: ... were depleted of endotoxin with the ToxinEraser Endotoxin Removal kit (GenScript) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Endotoxin levels were quantified using ToxinSensor™ Chromogenic LAL Endotoxin kit (GenScript) to ensure toxin purity.
-
bioRxiv - Neuroscience 2020Quote: ... with endotoxin levels determined using a LAL chromogenic endotoxin quantification kit (GenScript). Mouse or human α-synuclein fibrils were prepared by incubation of 7 mg ml -1 α-synuclein monomer of the same origin in phosphate-buffer saline for seven days at 37°C with constant agitation ...
-
bioRxiv - Microbiology 2021Quote: ... the cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (Genscript, L00847), was used as directed to detect antibodies that bind competitively to the receptor binding domain (RBD ...
-
bioRxiv - Biochemistry 2022Quote: The commercially available SARS-CoV-2 Neutralization Antibody Detection Kit (cPass, GenScript) was used to identify the presence of RBD neutralizing antibodies in the serum samples from mice immunized with r3CL-pro ...
-
bioRxiv - Developmental Biology 2022Quote: ... Inserts were ligated using GenBuilder™ Cloning Kit (Genscript, Piscataway NJ, USA) into pGL3-Basic (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... Endotoxin levels were determined using a LAL chromogenic endotoxin quantification kit (GenScript).
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit (GenScript, L00847-A) was used according to the manufacturer’s instructions as follows ...