Labshake search
Citations for GenScript :
51 - 100 of 142 citations for QuantiChrom Hemoglobin Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: Tubulin-kinesin-13 binding assay was carried out via immunoprecipitation using Ni-charged MagBeads (GenScript, NJ), to pull down Histidine-tagged kinesin-13 proteins ...
-
bioRxiv - Physiology 2019Quote: ... and absence of endotoxin (<0.25Eu/ml) was confirmed via the LAL gel-clot assay (GenScript, Piscataway, NJ).
-
bioRxiv - Biochemistry 2023Quote: The pull-down assays were executed using 25 μL of streptavidin-coated magnetic beads (Magbeads streptavidine, Genscript) loaded with 1 nmol of the biotinylated bait-peptides of interest ...
-
bioRxiv - Immunology 2021Quote: ... All neutralization assays performed with the surrogate Virus Neutralization Test (sVNT) (cat. n° L00847, GenScript, Piscataway, NJ, USA) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Microbiology 2022Quote: ... Toxin preparations were tested for lipopolysaccharide (LPS) contamination with the Toxin Sensor Chromogenic LAL Endotoxin Assay following the manufacturer’s instructions (GenScript). SEC preparations had < 0.02 ng of LPS per 20 µg of SEC+ ...
-
bioRxiv - Immunology 2023Quote: Determination of IL10-rs3024496 and IRF3-rs2304204 as functional SNPs was achieved using luciferase assay constructs ordered from GenScript. For IL10-rs3024496 ...
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Plant Biology 2019Quote: ... HIS-TAN1 and HIS-TAN1-GFP concentrations were checked with a BCA protein assay (Genscript Corp Piscataway, New Jersey USA). After refolding ...
-
bioRxiv - Biochemistry 2021Quote: ... The H4 substrate peptide used in the assay corresponds to the first 19 residues of human H4 (NH2-SGRGKGGKGLGKGGAKRHR-COOH; GenScript). In the assay ...
-
bioRxiv - Biochemistry 2022Quote: The N-terminal peptides of ParBpSM (residues 1-27) and ParBP1 (residues 1-30) used in the ATPase assays were synthesized by GenScript. The sequence of ParBpSM1-27 and its variant ParBpSM1-27 K10A were NH2-MIVGNLGAQKAKRNDTPISAKKDIMGD-CO2H (≥97 % purity ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Mpro inhibition assay was performed using the FRET-based fluorescent peptide substrate DABCYL-KTSAVLQ↓SGFRKM-E(EDANS)-NH2 (purchased from Genscript). The assay was standardized with enzyme concentration of 140 nM and 30 µM of fluorescent substrate in Mpro assay buffer containing (20 mM Tris pH 7.3 ...
-
bioRxiv - Microbiology 2021Quote: ... a panel of gH/gL and EphA2 variants to be tested in biophysical assays was ordered as synthetic genes (GenScript) cloned in pcDNA3.1 (+ ...
-
bioRxiv - Cell Biology 2023Quote: All peptides used for binding assays (Data S1) were synthesized with a N-terminal 5-carboxyfluorescien (5-FAM) at >85% purity (GenScript); peptides used for competition studies did not have 5-FAM ...
-
bioRxiv - Microbiology 2023Quote: ... Total protein was quantified using a BCA assay and 50 μg of each sample was prepared for loading onto 12% precast PAGE gels (GenScript). Wet transfers were performed onto 0.45 uM pore-sized PVDF membranes (Immobilon) ...
-
bioRxiv - Biophysics 2022Quote: The fluorescence-based binding assay employed chemically synthesized unlabeled RNA constructs (wt and mutants) prepared in-house and a peptide mimic (Genscript) of the Tat RNA binding domain N-AAARKKRRQRRR-C containing the arginine rich motif (ARM) ...
-
bioRxiv - Immunology 2021Quote: Antibodies inhibiting virus binding to host cell was measured using a commercial RBD-human angiotensin-converting enzyme 2 (hACE2) binding inhibition assay called cPASS™ (GenScript). As per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: The transcription template for the BoxB tethered assay is a derivative of our previously described template and was purchased from GenScript (35). The 5′ UTR was replaced with one of two 5′ UTR sequences possessing varying degrees of secondary structure:
-
bioRxiv - Microbiology 2023Quote: ... Fusion proteins were generated for the assay by cloning chlamydial DNA sequences encoding CPAF into a pET30a vector (constructed by Genscript Biotech), resulting in fusion proteins with a hexahistidine (His6 ...
-
bioRxiv - Genomics 2023Quote: ... with CloneEZ PCR Cloning Kit (GenScript #L00339). The pLenti-GIII-EF1α-CBX3-Flag-HA ...
-
bioRxiv - Immunology 2023Quote: ... the commercialized ELISA kit (Genscript, Cat#L00871) was used ...
-
bioRxiv - Immunology 2021Quote: SARS-CoV-2-specific T cell responses in rhesus macaque PBMCs were assessed by an IFN-γ ELISPOT assay using recombinant SARS-CoV-2 S1 protein (GenScript, Nanjing, China). Ninety-six-well plates (Millipore ...
-
bioRxiv - Pathology 2022Quote: ... bat sera were screened at a 1:10 dilution using a competitive enzyme linked immunosorbent assay (SARS-CoV-2 sVNT, GenScript, Piscataway, New Jersey) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... a toxin Eraser endotoxin removal kit (#L00338, Genscript) with a high efficiency endotoxin removal resin was employed ...
-
bioRxiv - Neuroscience 2023Quote: ... using the High-Affinity Antibody Purification Kit (L00404, GenScript) following the manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... endotoxin was removed with the ToxinEraser™ Endotoxin Removal Kit (Genscript), and the endotoxin level was measured using the ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (Genscript ...
-
bioRxiv - Microbiology 2020Quote: ... or with the ONE-HOUR Western™ Standard Kit (Genscript, China).
-
bioRxiv - Immunology 2020Quote: ... were depleted of endotoxin with the ToxinEraser Endotoxin Removal kit (GenScript) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... generated using the GenCrispr sgRNA Screening Kit (L00689; Genscript Biotech Corp.), and diluted to a concentration of 4 uM ...
-
bioRxiv - Microbiology 2022Quote: ... Endotoxin levels were quantified using ToxinSensor™ Chromogenic LAL Endotoxin kit (GenScript) to ensure toxin purity.
-
bioRxiv - Neuroscience 2020Quote: ... with endotoxin levels determined using a LAL chromogenic endotoxin quantification kit (GenScript). Mouse or human α-synuclein fibrils were prepared by incubation of 7 mg ml -1 α-synuclein monomer of the same origin in phosphate-buffer saline for seven days at 37°C with constant agitation ...
-
bioRxiv - Microbiology 2021Quote: ... the cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (Genscript, L00847), was used as directed to detect antibodies that bind competitively to the receptor binding domain (RBD ...
-
bioRxiv - Biochemistry 2022Quote: The commercially available SARS-CoV-2 Neutralization Antibody Detection Kit (cPass, GenScript) was used to identify the presence of RBD neutralizing antibodies in the serum samples from mice immunized with r3CL-pro ...
-
bioRxiv - Developmental Biology 2022Quote: ... Inserts were ligated using GenBuilder™ Cloning Kit (Genscript, Piscataway NJ, USA) into pGL3-Basic (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... Endotoxin levels were determined using a LAL chromogenic endotoxin quantification kit (GenScript).
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit (GenScript, L00847-A) was used according to the manufacturer’s instructions as follows ...
-
bioRxiv - Microbiology 2020Quote: Endotoxin of all purified proteins was removed with ToxinEraserTM Endotoxin Removal Kit (Genscript) in accordance to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit from GenScript (REF: L00847) was used according to manufacturer’s instructions ...
-
Development of monoclonal antibody-based blocking ELISA for detecting SARS-CoV-2 exposure in animalsbioRxiv - Microbiology 2023Quote: ... A cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript, Piscataway, NJ) was used and the test was performed following the instructions of the manufacture ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Some recombinants were generated by homologous recombination using GenBuilder Kit (GenScript Biotech Corporation) following manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... monomers and LPS were detected using endotoxin detection kit following the manufacturer’s protocol (GenScript ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit) ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection of blot was carried out with a LumiSensorTM HRP Substrate Kit (GenScript Technology).
-
bioRxiv - Microbiology 2021Quote: ... All the proteins were endotoxin free (ToxinEraserTM Endotoxin Removal Kit, GenScript Biotechnology, Nanjing, China).
-
bioRxiv - Immunology 2021Quote: Competitive inhibition ELISA was performed using SARS-CoV-2 neutralization antibody detection kit (Genscript). The kit detects circulating neutralizing antibodies against SARS-CoV-2 that block the interaction between the receptor binding domains of the viral spike glycoprotein (RBD ...
-
bioRxiv - Neuroscience 2021Quote: ... The bacterial endotoxins were removed by Toxineraser endotoxin removal kit (GenScript Biotech Corp., USA) followed with the measurement of the level of endotoxin by ToxinSensor Chromogenic LAL Endotoxin Assay Kit (GenScript Biotech Corp. ...
-
bioRxiv - Molecular Biology 2021Quote: The SARS-CoV-2 surrogate virus neutralization test (sVNT) kit was obtained from GenScript Inc ...
-
bioRxiv - Cell Biology 2023Quote: ... Blots were developed using the Lumi Sensor Chemiluminescent HRP Substrate kit (Genscript, United States) and SuperRX Fuji medical X-Ray films (Fuji FILM ...