Labshake search
Citations for GenScript :
451 - 500 of 521 citations for Primary Human Aortic Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... KIR2DL3 stable HEK293F cell lines were established to evaluate the molecules recognizing the KIR receptors using pcDNA3.1 vectors (OHu24667C, OHu17046C, OHu55562C) (GenScript). The live cells were stained for NK and CD8+ T cell surface markers (anti-CD3 ...
-
bioRxiv - Microbiology 2022Quote: ... hACE2-Fc was produced in Expi293F cells and purified from the clarified culture supernatant using Protein G-Agarose (Genscript) followed by SEC on a Superdex 200 16/600 column linked to an AKTApure instrument (Cytiva) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were treated with 5 μM of recombinant (PR)20 peptides (with a C-terminal HA epitope tag, Genscript) for 10 days ...
-
bioRxiv - Immunology 2022Quote: ... KIR-CD3ζ JNL cells were also incubated with parental 721.221 cells as negative control and with anti-Flag-tag (5 µg/ml) (clone 5A8E5, GenScript) and goat anti-mouse (10 µg/ml ...
-
bioRxiv - Cell Biology 2023Quote: DNA sequences used for plasmid construction were either amplified from the cDNA of HEK293T cells or purchased from GenScript and WZ Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... α-factor was added to the cells to a final concentration of 5 ng/ml α-factor (GenScript RP01002) for 3 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... competent cells were transformed with 50 ng of pGEX-4T-1-GST-TEV.TZF WT/NLSmut expression vector synthesized by Genscript and containing TTP TZF domain (amino acids 93-165 ...
-
bioRxiv - Immunology 2023Quote: ... 5×105 cells per well (6 well plate) were stimulated with 100 ng/mL of IFN-γ (Z02916, Genscript) for 0 h ...
-
bioRxiv - Biophysics 2024Quote: ... The CBX8KR21A mutant open reading frame was codon optimised for expression in Trichoplusia ni insect cells and synthesised (Genscript). The CBX8ΔChromo truncation was amplified from the wildtype ORF using primers indicated in Table 1 and then subcloned into a vector with the same backbone as used to expresses the wild type protein ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Pfs25 was expressed and purified from a baculovirus expression system using Spodoptera frugiperda SF9 cells and P2 virus by Genscript.
-
bioRxiv - Genomics 2022Quote: ... G1 synchronization was achieved by incubating 700 ml of exponentially growing (OD600 0.2) bar1 cells with a final concentration of 5 ng/ml of alpha-factor (GenScript RP01002) for 3 hours ...
-
bioRxiv - Biochemistry 2021Quote: ... to reflect the reducing conditions in the cytoplasm of the cell) and AQP4ct (Ac-256VEFKRRFKEAFSKAAQQTKG SYMEV280-NH2) peptides were synthesized by Genscript Inc ...
-
bioRxiv - Biochemistry 2021Quote: ... Peptide-pulsing of target cells was performed by incubating EBV-LCLs in FBS-free medium at a density of 5×106 cells/ml for 2 hours in the presence of individual peptides (107 pg/ml, Genscript). After an overnight incubation ...
-
bioRxiv - Cell Biology 2021Quote: The plasmid directing expression of mouse ARL16-myc in mammalian cells was obtained by first having the open reading frame synthesized by GenScript and later using PCR to amplify this open reading frame with insertion of the C-terminal myc epitope (EQKLISEEDL ...
-
bioRxiv - Biophysics 2020Quote: ... and TIN2S (HA-TIN2S, 1-354 aa) were expressed in the Sf-900 insect cells using the pFastBac1 expression system (GenScript). HA-TIN2L and HA-TIN2S were purified using anti-HA resin and stored in a buffer containing 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Cancer Biology 2021Quote: ... CAR T cells were evaluated for CAR expression on the surface by flow cytometry with protein L (1:100; M00097, Genscript) as previously described(47) ...
-
bioRxiv - Biochemistry 2022Quote: Heavy and light chain sequences of CS-17 were determined from sequencing of CS-17 murine hybridoma cell line PTA-8174 (ATCC) by Genscript. The resulting sequences were cloned into a pCDNA3.4-containing murine IgG2a construct ...
-
bioRxiv - Biochemistry 2020Quote: ... Yields of the cell-penetrating peptide were determined by comparing tryptophan absorbance at 280 nm to that of a peptide standard (Genscript). This peptide product was verified by time-of-flight electrospray ionization cationic mass spectroscopy Agilent QTOF 6540) ...
-
bioRxiv - Immunology 2020Quote: ... BMDCs (105 cells) were incubated overnight in the presence of 10 μg/ml of influenza HA518–526 (IYSTVASSL) peptide (Genscript). IMALs were isolated from treated mice and A205804 was added to the plate for 5 d ...
-
bioRxiv - Immunology 2020Quote: ... and the S1-Receptor Binding Domain (S1-RBD; Cat. No Z03483; expressed in HEK293 cells) were purchased from by GenScript. The S1-N-terminal domain (S1-NTD ...
-
bioRxiv - Immunology 2021Quote: ... The full-length S-genes were codon optimized for expression in Spodoptera frugiperda (Sf9) cells and synthetically produced by GenScript® service (GenScript USA ...
-
bioRxiv - Biochemistry 2020Quote: ... two stable sub-clonal cell lines of each parental clone were chosen for cryopreservation based on the result of ELISA (GenScript). Positive cell supernatants were evaluated by WB against 200 ng of purified protein/lane using a 1:10 dilution in-house as described ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 ml of supernatant (conditioned media) were collected for each clone and cells were frozen down to avoid clone loss (GenScript). The conditioned media of all 10 positive clones were analyzed in-house by WB against 200 ng of purified protein/lane using a 1:10 dilution as described ...
-
bioRxiv - Biochemistry 2021Quote: The Chinese Hamster Ovary-glutamine synthetase (CHO-GS) engineered cell line for production of Trastuzumab was kindly provided by GenScript Biotech Corporation (Piscataway ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were plated in a 6 well plate and co-transfected with 1 μg of pUC57-NASP-FKBP12F36V (by Genscript) and 2 μg of pSpCas9(BB)-2A-Puro-NASP-sgRNA_V2.0 (#62988 ...
-
bioRxiv - Cell Biology 2019Quote: IL-6 concentrations in the cell supernatant were were detected utilizing mouse IL -6 ELISA kit t (A015171517) purchased from GenScript Biological Technology Co.Ltd ...
-
bioRxiv - Immunology 2020Quote: ... Peptide-specific T cell lines were grown similarly using autologous irradiated BLCLs pulsed with 15-mers A3C-1 and A3C-B (GenScript).
-
bioRxiv - Immunology 2020Quote: The SARS-CoV-2 pseudovirus was produced by co-transfection of HEK293T cells with 1:1 ratio of DNA plasmid encoding SARS-CoV-2 S protein (GenScript) and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent ...
-
bioRxiv - Immunology 2020Quote: ... Cells were cultured at 5e5 cells/well with two peptide pools representing the full-length S protein at 1 μg/ml (Genscript) overnight in order to stimulate the cells ...
-
bioRxiv - Immunology 2022Quote: ... The recombinant monoclonal antibodies of IgG subtypes were purified after incubation of filtered Expi293F cell supernatant with Protein G resin beads (GenScript) at 4°C overnight ...
-
bioRxiv - Microbiology 2022Quote: ... flanked with Sal I & Not I was codon-optimized using the UpGene algorithm for optimal expression in mammalian cells [52] and synthesized (GenScript). The construct also contained a Kozak sequence (GCCACC ...
-
bioRxiv - Immunology 2022Quote: ... The S gene was codon optimized for high level expression in CHO mammalian cells and biochemically synthesized by Genscript (China). Compared to the reference gene ...
-
bioRxiv - Immunology 2023Quote: ... flanked with Sal I & Not I was codon-optimized using the UpGene algorithm for optimal expression in mammalian cells (68) and synthesized (GenScript). The construct also contained a Kozak sequence (GCCACC ...
-
bioRxiv - Bioengineering 2023Quote: ... The cells bearing different constructs were labeled with anti-FLAG-iFluor 488 and anti-HPC4-iFluor 647 antibodies (GenScript, China) followed by detection using similar protocols published previously(21 ...
-
bioRxiv - Microbiology 2023Quote: ... XG014 and DXP-604 were produced by transfection of HD CHO-S cells with plasmids in a 30-ml volume (GenScript). Monoclonal IgA1 antibodies were produced in CHO cells transiently transfected with two plasmids expressing a heavy and light chain ...
-
bioRxiv - Cancer Biology 2023Quote: The inducible L1 reporter plasmid used to generate HeLa tet-L1/GLucAI cells (pBH001) was generated through a series of successive PCR-based cloning steps performed by GenScript. pBH001 is comprised of a tetracycline-regulated bidirectional promoter for inducible expression of both firefly luciferase (a fragment cloned from the pTRE3G-BI-Luc control plasmid (Takara Bio) ...
-
bioRxiv - Immunology 2023Quote: ... TAP1 deficient 221-C*08:02 cells were generated by expression of HLA-C*08:02 in 221-Cas9 cells followed by transduction with two gRNA targeting TAP1 (Genscript)42 ...
-
bioRxiv - Biochemistry 2023Quote: The ThPlsB protein was expressed in E coli C41(DE3) cells by using pET 21b vector with synthesized cDNA (codon optimized through the GenSmart system from GenScript). The LB media with 0.1 mg mL−1 ampicillin were used for cell culture ...
-
bioRxiv - Biochemistry 2023Quote: The Chinese hamster ovary (CHO-K1) cell line producing a recombinant mAb biosimilar of Trastuzumab was kindly donated by GenScript Biotech Corporation (Piscataway ...
-
bioRxiv - Neuroscience 2023Quote: ... SnifferOT cells were transiently transfected to express the red fluorescent genetically encoded calcium indicator R-GECO (GenScript, Piscataway, NJ, USA) with Fugene HD reagent (Promega ...
-
bioRxiv - Synthetic Biology 2023Quote: ... This was then back diluted 1:10 into DMEM-FBS media used for growing LLC-sppIP cells or fresh media containing synthetic sppIP peptide (Genscript). Media from LLC-sppIP cells was collected after 24 h of growth in 96 well plates.
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 sequences (Genbank accession number MN908947) were codon-optimized for Chinese Hamster Ovary (CHO) cells and synthesized by GenScript. Within the construct ...
-
bioRxiv - Biochemistry 2024Quote: Cloning of hPINK1 constructs for insect cell expression and test purifications The coding sequences for the PINK1 constructs were PCR amplified using clone OHu25380D (Genscript) as a template and cloned into the vector pFB-6HZB (SGC ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were transiently transfected with plasmids containing receptors of interest under eukaryotic expression promoters (ASGR1 was clone OHU03658D from GenScript), then split into 96-well plates (20,000 cells per well ...
-
bioRxiv - Microbiology 2024Quote: ... lentiviruses were generated in HEK293T cells by transfection of pLentiCRISPRv2 -Puro plasmid containing a single guide RNA (sgRNA) (GTACTGTAGATGGTGCTCAT) (GenScript) targeting ACE2 ...
-
bioRxiv - Microbiology 2023Quote: 8xHis-zz-TEV-mBICD2 (full-length or truncated 1-560) was codon optimized for expression in SF9 insect cells and synthesized by Genscript. The genes were subcloned into pFastBac using NEBuilder HiFi DNA assembly (NEB E2621S) ...
-
bioRxiv - Biochemistry 2024Quote: ... fused to consecutive C-terminal HA (hemagglutinin)- and FLAG-tags and cloned into pCDNA-3.1 plasmid for expression in HEK293 cells by the CMV (cytomegalovirus) promoter (GenScript Biotech). Mutant variants were generated by site directed mutagenesis (GenScript Biotech).
-
bioRxiv - Cell Biology 2024Quote: The human K6a sequence flanked by an amino-terminal HA tag and a carboxyl-terminal Flag tag (HA-hK6a-FLAG) was generated by PCR using pUC57-hK6a as a template which is codon-optimized for mammalian cell expression (Genscript). The sequence was inserted into lentiviral expression vector pCDH533-IRES-Neo (System Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... Di-thiolated peptides that are susceptible to metalloproteinase (MMP) cleavage (GCNSVPMSMRGGSNCG) and thiolated cell-adhesive peptides (GCGYGRGDSPG) were obtained from Genscript. HA hydrogels were fabricated by mixing 4 wt% norbornene-modified HA with 0.05 wt% photo-initiator lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP ...
-
bioRxiv - Immunology 2024Quote: ... spleen single cell suspensions were incubated for 4h at 37°C in the presence of gp33 peptide (1 µg/mL KAVYNFATC; Genscript), brefeldin A (5 µg/mL ...