Labshake search
Citations for GenScript :
51 - 100 of 173 citations for Prestained SDS PAGE Standards Single Color since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... SDS-PAGE was performed using 30 μ l of sample with 4-20% Bis-Tris gels (Genscript) in Tris-MOPS-SDS running buffer (Genscript) ...
-
bioRxiv - Molecular Biology 2019Quote: Samples were run on either 4-20% Express Plus PAGEs in Tris-MOPS-SDS running buffer (GenScript), 10% Criterion TGX gels (BioRad ...
-
bioRxiv - Cell Biology 2020Quote: ... A total of 40 µg proteins were separated by 4-20% gradient SDS-PAGE gels (GenScript, M42015C) and transferred to PVDF membranes (Millipore ...
-
bioRxiv - Cancer Biology 2023Quote: ... and electrophoresed in 4-12% Express-Plus PAGE gels in Tris-MOPS (SDS) running buffer (GenScript #M00138). Proteins were transferred onto PVDF membranes ...
-
bioRxiv - Developmental Biology 2021Quote: ... Protein samples were separated by SDS-PAGE on 4-12% gradient gels (ExpressPlus, Genscript, New Jersey, NJ, USA). Each gel lane was cut into 6 equal slices ...
-
bioRxiv - Molecular Biology 2021Quote: ... All purification steps were monitored either by Coomassie-stained SDS-PAGE or anti-HIS western blot (Genscript #A00186). HMT assays were essentially performed as described in (Frapporti et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... equal amounts of lysates were loaded and separated by SDS-PAGE using 4-12% SurePAGE Bis- Tris (GenScript) or 3-8% NuPAGE Tris-Acetate (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: Proteins in the digesta were separated and quantified by SDS-PAGE with 4-20% precast gel (Genscript, USA). Each sample was diluted and mixed with 5× loading buffer to reach the concentration of 4 mg/mL ...
-
bioRxiv - Biochemistry 2020Quote: ... Purity was measured by SDS-PAGE and concentration by NanoDrop Spectrophotometer A280nm (Thermo Fisher Scientific Inc., Waltham, Massachusetts) (GenScript). This way 36.38 mg of 7C11 with 95% purity ...
-
bioRxiv - Plant Biology 2022Quote: ... The immunoprecipitated proteins were separated by SDS-PAGE electrophoresis and detected by anti-GST (A00865-200, 1:5,000, Genscript) and anti-MBP (E8032 ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were analyzed by SDS-PAGE and detected by immunoblotting using antibodies to the strep tag (1:3,000; A01736-100, GenScript) and His tag (1:1,500 ...
-
bioRxiv - Biophysics 2021Quote: ... Samples were incubated for 5 minutes at 95 °C and run on a 4-20% gradient SDS-PAGE gel (Genscript).
-
bioRxiv - Cancer Biology 2022Quote: ... Equal amounts of protein (nominally 50 μg) from each sample were separated on 4-20% gradient Bis-Tris SDS-PAGE gels (GenScript), and protein was then electroblotted onto low autofluorescence PVDF membrane (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... The samples were then heated for 5 minutes at 85°C and separated by SDS-PAGE and analyzed by Western blot using rabbit anti-GST antibody (Genscript), rabbit α-RSV CA ...
-
bioRxiv - Neuroscience 2019Quote: ... Equal volumes of supernatants and pellets were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analysis on 8-16% Bis-Tris gels (Genscript) that subsequently were stained with Coomassie blue R-250 (Supplementary fig ...
-
bioRxiv - Biochemistry 2022Quote: ... middle and bottom of the gradient were collected and 15 μL of each were mixed with 4 μL 4x loading buffer and heated for 3 mins before SDS-PAGE gel electrophoresis (SurePAGE 10% Bis-Tris, GenScript).
-
bioRxiv - Biochemistry 2023Quote: ... Eluted fractions were analyzed using sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE; Figure S1) gels run under denaturing conditions using SurePAGE Bis-Tris gels (GenScript) and MES-SDS running buffer (GenScript ...
-
bioRxiv - Microbiology 2023Quote: Pelleted virions were dissolved in SDS-PAGE sample buffer and subjected to electrophoresis on precast 4-20% gradient gels using Tris-MOPS running buffer (Genscript). Proteins were transferred to Protran nitrocellulose membranes (Perkin-Elmer ...
-
bioRxiv - Cell Biology 2023Quote: ... 15-30 μg protein were loaded and separated by SDS-PAGE in 4–12% SurePAGE 12-well pre-cast gels (Genscript). Proteins were transferred onto PVDF membranes using iBlot or iBlot2 system (Thermo) ...
-
bioRxiv - Biochemistry 2024Quote: ... Equivalent aliquots (15 µL) of each fraction were analysed by SDS-PAGE and immunoblotting using anti-His tag antibody (GenScript) overnight at 4°C as per manufacturer’s instructions ...
-
bioRxiv - Pathology 2019Quote: ... The samples were loaded onto a 12% (vol/vol) SDS/PAGE gel and target proteins were detected using a polyclonal anti-GFP antibody (GenScript, USA) or a monoclonal anti-FLAG (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... active protein fractions were further separated through sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; 4%–20% Bis-Tris Gel; GenScript, USA). Proteins in the gel slices were eluted in HEPES-K+ buffer (50 mM ...
-
bioRxiv - Microbiology 2021Quote: ... and 20 μg of protein lysates from each sample were denatured in 4X LDS sample buffer followed by separation on 4–12% gradient SDS PAGE polyacrylamide gel (Genscript, #M00653). Separated proteins on the polyacrylamide gel were transferred to a 0.2 μm PVDF membrane (Thermo Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... The harvested cell pellets were analysed by SDS-PAGE and probed by western blot with an anti-Flag antibody (Genscript A01868).
-
bioRxiv - Immunology 2021Quote: Purified RBD was loaded at 0.2 µg/well and electrophoretically separated by SDS-PAGE under non-reducing conditions and transferred to nitrocellulose membranes using an e-blot device (GenScript Laboratories, USA). The membranes were blocked with 5% (w/v ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... His-PFOR over-expression in the 6-L cultures was assessed by SDS PAGE analysis followed by immunoblotting with a His-tag specific antibody (GenScript; Fig S7). A specific band could be detected in the over-expression mutant ...
-
bioRxiv - Cell Biology 2023Quote: Keratinocytes near confluency were extracted using 2X Laemmli Buffer.53 Samples were then loaded on a SurePAGE 4-12% Bis-Tris SDS-PAGE gel (Genscript, Piscataway, NJ) under denaturating conditions followed by protein transfer onto Immuno-Blot® PVDF Membranes (Bio-Rad Laboratories ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Lysates were mixed with Native-PAGE sample buffer 5X (Beyotime) and subjected to Native-PAGE using ExpressPlus™ 4-12% PAGE Gel (GenScript) and Tris-MOPS-SDS Running Buffer (GenScript) ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Immunology 2023Quote: ... A standard curve was generated using a serial dilution of the standard (GenScript, A02087-20) with a dilution factor of 1:2 ...
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Synthetic Biology 2022Quote: ... a multi-tag protein standard (Genscript) was serially diluted in 1xTBS with 0.5% Tween-20 buffer ...
-
bioRxiv - Microbiology 2020Quote: ... and loaded onto ExpressPlus PAGE gel (Genscript). Proteins were transferred onto polyvinylidene difluoride (PVDF ...
-
bioRxiv - Biochemistry 2024Quote: ... Tris-MOPS-SDS gels (GenScript). The resolved proteins were then transferred to PVDF membranes (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: ... using MES SDS running buffer (GenScript) in a Bio-Rad Mini-PROTEAN Tetra Cell (BioRad ...
-
bioRxiv - Biochemistry 2023Quote: ... and MES-SDS running buffer (GenScript) followed by staining using the eStain L1 Protein Staining System (GenScript) ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were separated on ExpressPlus™ PAGE gels (GenScript) and transferred to PVDF membrane (MERCK-Millipore) ...
-
bioRxiv - Microbiology 2022Quote: ... in Tris-MOPS-SDS running buffer (Genscript), and proteins were transferred to PVDF membrane ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and Tris-MOPS-SDS Running Buffer (GenScript). Then extracted proteins were transferred to a nitrocellulose membrane ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Tris-MES-SDS Running buffer (GenScript). The gel used for Western blotting was not stained ...
-
bioRxiv - Microbiology 2023Quote: ... Tris-MOPS-SDS running buffer (GenScript, #M00138); Biotin-oligo d(T ...
-
bioRxiv - Neuroscience 2023Quote: ... A single-stranded DNA repair construct (synthesized by Genscript) with the sequence 5’- CTGGGCTGACAAACATCAAGACGGAAGAGATCTCGGAAGTGAAGATGGATGCAGA ATTCCGACATGATTCAGGATATGAAGTCCATCATCAAAAACTGGTAGGCAAAAATAAACTGCCTCTCCCCGAGATTGCGTCTGGCCAGATGAAAT-3’ was used to introduce the G601R ...
-
bioRxiv - Microbiology 2020Quote: ... The reaction was quenched by SDS sample buffer and analyzed by 4-20% SDS-gel (GenScript, Piscataway, NJ, US). Fluorescent ubiquitin signals were imaged using Thermo iBright exposed for 750 ms.
-
bioRxiv - Microbiology 2023Quote: ... A synthetic standard containing base positions 1-200 from the 16S rRNA gene sequence was used for the standard curve (GenScript, Rijswijk, Netherlands). The qPCR was carried out on a Strategene Mx3005P qPCR machine (Agilent Technologies ...
-
bioRxiv - Biochemistry 2021Quote: ... Human anti-SP IgG standards (chimera, GenScript, Piscataway, NJ) or human ACE-2 Fc (chimera ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1% SDS and 0.1 mM EDTA (M00138, GenScript) at 100V for 200 min in a Mini Gel Tank system (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... using MES-SDS running buffer (GenScript Cat. #M00677). The proteins were transferred on 0.2 µm pore-diameter Immobilon–pSQ PVDF membrane (Cat ...
-
bioRxiv - Biophysics 2021Quote: ... Single-chain MspA genes were ordered from GenScript (Piscataway, NJ). Description of construction of single-chain MspA M2 and single-chain MspA PN1 plasmids are in the SI Appendix.
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were separated in 4-20% gradient precast PAGE gels (Genscript) and stained by Coomassie blue.
-
bioRxiv - Systems Biology 2020Quote: ... resolved on a 4-20% gradient ExpressPlus™ PAGE gels (GenScript) and transferred to PVDF membranes (Thermo Fisher Scientific ...