Labshake search
Citations for GenScript :
1 - 50 of 306 citations for Potassium 3 4 difluorophenyl trifluoroborate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... LNP #3 (ALC0315) and LNP #4 (LP01) encapsulating f-luciferase mRNA also were provided by Genscript.
-
bioRxiv - Bioengineering 2021Quote: De novo gene synthesis of the designed potassium sensor including Ec-Kbp and identified homologs and subsequent subcloning into the pBAD-HisD vector were done by Genscript. The genes were codon-optimized for human cells ...
-
bioRxiv - Biochemistry 2022Quote: ... middle and bottom of the gradient were collected and 15 μL of each were mixed with 4 μL 4x loading buffer and heated for 3 mins before SDS-PAGE gel electrophoresis (SurePAGE 10% Bis-Tris, GenScript).
-
bioRxiv - Biochemistry 2024Quote: ... non-targeting sgRNA (TGCTTTACCGCGTTGGGTAA) or CLYBL targeting sgRNA (exon 2: CATAGAGCACTGCTCTCCGG; exon 3: AGACTTTGACCTGGGCACAA; exon 4: CCATTGCAGTCTCCACAAAG) were purchased from Genscript. Plasmids were transformed into OneShot™ E ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Plant Biology 2024Quote: ... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
bioRxiv - Biochemistry 2020Quote: ... Rpc5-WH3/4 and Rpc5-WH1/4 from its genomic DNA (Genscript). The constructs were subsequently cloned into pOPINF or pOPINJ plasmids for bacterial expression or into pACEBac1 plasmid for baculovirus–insect cells expression ...
-
bioRxiv - Genetics 2024Quote: ... and bam 3’UTR by Genscript, Inc (Piscataway ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Cell Biology 2023Quote: Western blots were performed using ExpressPlus PAGE Gel 4-12% or 4-20% (GenScript). Proteins were transferred to PVDF membranes (MERCK-Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... Gradient gels (4-12% GenScript) were used in all experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4%-20% (GenScript, M00657) precast gradient gels and transferred to a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-12% gel (GenScript, #M00654) and separated by MOPS buffer (GenScript ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
TRANSITION OF PODOSOMES INTO ZIPPER-LIKE STRUCTURES IN MACROPHAGE-DERIVED MULTINUCLEATED GIANT CELLSbioRxiv - Cell Biology 2020Quote: ... IL-4 was from Genscript (Piscataway, NJ).
-
bioRxiv - Microbiology 2023Quote: ... 4%-20% gradient SurePAGE gel (GenScript, #M00657); Tris-MOPS-SDS running buffer (GenScript ...
-
bioRxiv - Immunology 2023Quote: ... or 4-20% gradient gels (GenScript #M00656). Proteins on gels were transferred to nitrocellulose membranes (Bio-Rad #1620115 ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Biophysics 2024Quote: ... nucleotide sequence 5’ GCA GTG CTC CAA AGC GGA TTT CGC 3’) of mSca-containing DuProSense with PLpro cleavage sites (Supporting Table 3) (GenScript Biotech (Singapore) Pte ...
-
bioRxiv - Biophysics 2024Quote: ... nucleotide sequence 5’ CTG AAA GGC GGC GCG CCG ACC AAA 3’) of mSca-containing DuProSense with Mpro cleavage sites (Supporting Table 3) (GenScript Biotech (Singapore) Pte ...
-
bioRxiv - Biochemistry 2021Quote: ... which contained an intact 3’UTR (GenScript, Piscataway, NJ). Two concentrations of Zfp36l1 (WT and mutant ...
-
DeFrND: detergent-free reconstitution into native nanodiscs with designer membrane scaffold peptidesbioRxiv - Biophysics 2024Quote: ... and eluted with 3 x Flag peptide (GenScript, RP21087), concentrated using an Amicon™ Ultra-4 centrifugal filter (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... hydrogels of varying Young’s modulus: 5 kPa (4% 20 kDa 4-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript), 12 kPa (5% 40 kDa 8-arm PEG-NB ...
-
bioRxiv - Biochemistry 2024Quote: ... CRISPR/Cas9 engineered HEK-293 cell lines (uS-4-Flag, uS-13-Flag, and uL-4-HA tagged HEK-293 cells, Genscript) were treated as HEK T-RExTM-293 cells ...
-
bioRxiv - Cell Biology 2024Quote: ... Equal amount of total protein (typically 20 or 30 µg/sample) were separated either on 4-12% or 4-20% SurePAGE Bis-Tris gels (Genscript) and transferred on nitrocellulose membrane (Merck Millipore ...
-
bioRxiv - Microbiology 2020Quote: ... Fragment 4 was ordered as synthetic sequence (GenScript) with the first 274 bp recodonised and was amplified from plasmid pUC57-re-ap2-hc-1 using primers ap2-hc-5'_HR2_re_F and ap2-hc-5'_HR2_re_R.
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were resolved on 4%-12% (GenScript, M00654) or 4%-20% (GenScript ...
-
bioRxiv - Developmental Biology 2023Quote: ... then 4 × LDS sample buffer (GenScript, M00676-10) was added ...
-
bioRxiv - Bioengineering 2024Quote: ... or 4 μg BMP-2 (Genscript, Piscataway, NJ) per mg GMs ...
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Supplementary Table 3) and synthesized in vitro (Genscript). For protein expression ...
-
bioRxiv - Plant Biology 2022Quote: ... and AtNLP1-3 were codon-optimized and synthesized by Genscript, NJ ...
-
bioRxiv - Molecular Biology 2023Quote: ... All utrophin 3’UTR reporter constructs were generated by GenScript Biotech (Leiden ...
-
bioRxiv - Molecular Biology 2023Quote: The published DARPin TM-3 sequence22 was synthesized by GenScript and cloned into a pST50 expression vector27 with N-terminal 6x His tag using Gibson assembly ...
-
bioRxiv - Neuroscience 2024Quote: ... Urocortin 3 (Ucn3; GenScript USA, Piscataway, NJ: 60pmol/0.4μl/side) was dissolved in DMSO (10% v/v final concentration ...
-
bioRxiv - Physiology 2022Quote: ... PAR-4 Agonist peptide (RP11529) was purchased from GenScript, Piscataway ...
-
bioRxiv - Cell Biology 2023Quote: ... The recombinant Hsc70-4 protein was produced by GenScript by expression of the recombinant protein with a 6X His tag in E ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human OTUD4 (isoform 4 NP_001352986.1) was purchased from GenScript. Human OTUD4 constructs were cloned without tag or with FLAG-tag into the expression plasmid pcDNA3.1 (Life technologies ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...