Labshake search
Citations for GenScript :
1 - 50 of 642 citations for Piggybac Transposable Element Derived 3 PGBD3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... This element was synthesized (GenScript, USA) and subsequently subcloned between the sugarcane Ubi4 promoter and T35S terminator ...
-
bioRxiv - Microbiology 2023Quote: ... gH was detected using custom-made polyclonal rabbit antibodies raised against peptides derived from KSHV gH (Genscript).
-
bioRxiv - Biochemistry 2021Quote: ... Stalk-derived peptides were synthesized by GenScript using the Fmoc method and verified by HPLC-MS analysis.
-
bioRxiv - Molecular Biology 2022Quote: Synthetically derived EPs were purchased from Genscript. Dried peptides were dissolved in ice-cold deionized water to a concentration of 500 μM and stored on ice until analyzed ...
-
bioRxiv - Cell Biology 2022Quote: ... RGD-containing peptides derived from SARS-CoV-2 (ADSFVIRGDEVRQIAPGQTG) and KGD-containing peptides derived from SARS-CoV (ADSFVVKGDDVRQIAPGQTG) were produced by Genscript. Integrin-blocking (GRGDSP ...
-
bioRxiv - Microbiology 2020Quote: ... Full-length PbCSP and PbCSP-derived peptides (GenScript) were diluted in Tris-buffered saline (TBS ...
-
bioRxiv - Biophysics 2022Quote: ... HSPB5 NTR-derived synthetic peptides were purchased from Genscript. All peptides were produced with N-terminal formylation and C-terminal amidation ...
-
bioRxiv - Neuroscience 2024Quote: ... 20 ng/mL Brain-derived neurotrophic factor (BDNF, GenScript), 20 ng/mL Glial Cell Line-derived Neurotrophic Factor (GDNF ...
-
bioRxiv - Immunology 2021Quote: ... and a peptide derived from TM87B were manufactured by Genscript.
-
bioRxiv - Biochemistry 2023Quote: All Mint-derived synthetic peptides were purchased from Genscript (USA). The human APP(750-769 ...
-
bioRxiv - Neuroscience 2024Quote: ... 20 ng/mL Glial Cell Line-derived Neurotrophic Factor (GDNF, GenScript) in a 5% CO2 atmosphere at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... α-actinin-1 and myotilin derived peptides were obtained from Genscript (USA). For immunofluorescence imaging we used goat anti-human VPS35 (Abcam ...
-
β-amyloid−driven synaptic depression requires PDZ protein interaction at AMPA-receptor subunit GluA3bioRxiv - Neuroscience 2021Quote: ... The following antibodies were used: anti-GluA2/3 (1:2000; CQNFATYKEGYNVYGIESVKI, custom made at Genscript) (Chen et al. ...
-
bioRxiv - Immunology 2020Quote: Selected nonpeptides and LncRNA-derived peptides were in vitro synthesized by GenScript (Piscataway, NJ). Selected melanoma CG antigen-derived peptides were synthesized by the Peptide Synthesis and Antigen Discovery Core ...
-
bioRxiv - Immunology 2024Quote: ... All segments were cloned into a bi-directional transcription plasmid derived from pUC57 (Genscript) including polymerase (Pol ...
-
bioRxiv - Cancer Biology 2022Quote: A total of 376 predicted and mass-spec identified neoantigen-derived peptides were synthesized (GenScript) and each was added to 6 of 11 peptide pools such that each neoepitope (or group of similar neoepitopes ...
-
bioRxiv - Immunology 2024Quote: ... Cells were stimulated with an overlapping peptide pool derived from SARS-CoV-2 Spike protein (Genscript). Following 2 hours of culture ...
-
bioRxiv - Cell Biology 2024Quote: ... Serum-free medium containing 20 ng/ml platelet-derived growth factor-BB (PDGF-BB) (Z02892, GenScript) was used to trigger Erk1/2 activation ...
-
bioRxiv - Cancer Biology 2022Quote: ... additional genetic elements (e.g E2A sequence [31]) and useful flanking restriction sites were all synthesized from GenScript USA (New Jersey ...
-
bioRxiv - Plant Biology 2020Quote: ... derived from the third exon (see Source data files for probe sequence) was synthesized (GenScript Biotech, Netherlands). The aforementioned approach described for COM1 was conducted for in situ hybridization.
-
bioRxiv - Cell Biology 2023Quote: ... and spleen-derived B-cells were combined with myelomas to create hybridomas (GenScript Biotech, Piscataway, NJ, USA). Monoclonal antibody 13G3 was raised against hCABS1 aa 375-388 TSTTETDIFELLKE (underlined anti-inflammatory sequence) ...
-
bioRxiv - Microbiology 2021Quote: ... Selected small proteins and small protein derived peptides from high-and medium observed abundance were chemically synthesized (Genscript) and subjected to LC-MS/MS as above ...
-
bioRxiv - Biochemistry 2022Quote: ... Wells were washed 3 times in PBS and incubated with 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984) for 1 hour at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... 0.1×106 mouse splenocytes were plated into each well and stimulated overnight with 0.2 µg per peptide per well of RBD-derived overlapping peptides (GenScript).
-
bioRxiv - Biophysics 2023Quote: ... BRET fusion constructs for Gαi1-91-Rluc8 and Gγ9-GFP2 were derived from optimized Tru-path constructs76 and sub-cloned into pcDNA3.1(+) (Genscript Biotech).
-
bioRxiv - Biochemistry 2024Quote: ... The final EfpA-EM construct was derived from BRIL-EfpA by mutating proline at position 171 to arginine (GenScript) to provide possible interactions that might help order the BRIL domain.
-
bioRxiv - Cell Biology 2021Quote: ... which was synthesized to contain 7 modified TetO elements flanked by two minimal CMV promoter sequences based on pTet-T2 sequences (GenScript) (49) ...
-
bioRxiv - Microbiology 2021Quote: ... RBD-binding peptide SBP1 derived from human ACE2 α helix 1 (Ac-IEEQAKTFLDKFNHEAEDLFYQS-NH2) was synthesized by GenScript (Nanjing, China).
-
bioRxiv - Cancer Biology 2021Quote: ... we first synthesized a cassette coding the FKBP-derived destabilization domain (DD)33 along with an EcoRI restriction site and a single FLAG tag (Genscript). This cassette was then cloned into pHIV-NAT-T2A-hCD52 (kind gift of R ...
-
bioRxiv - Immunology 2021Quote: ... RBD was attached to Helicobacter pylori ferritin using a GSGGGG linker followed by a short sequence (ESQVRQQFSK) derived from bullfrog ferritin (59) and synthesized by GenScript, to include a N-terminal hexa-histadine (his ...
-
bioRxiv - Molecular Biology 2021Quote: The substrate for this reaction is a synthetic TNF-derived peptide first developed by Schuster et al (Schuster, Roessler et al., 2016) was synthesized by Genscript. Reactions were performed with 150 mM NaCl ...
-
bioRxiv - Immunology 2020Quote: ... The Pmel-1 melanoma antigen-derived peptide mgp10025-33 (EGSRNQDWL) (32) was custom synthesized by GenScript (Scotch Plains, NJ, USA) to more than 80% purity ...
-
bioRxiv - Biochemistry 2023Quote: The DBC1-NHD fragment (residues 354-396) derived from the human DBC1 (Uniprot code: Q8N163) was synthesized and subsequently cloned into the pETM41 vector by GenScript Biotechnology Co. ...
-
bioRxiv - Microbiology 2024Quote: ... The promoters and the pIB184-derived region (repD and repE for replication in Lactobacilli and erythromycin resistant gene ermB) were synthesized by GenScript. PrimerSTAR Max polymerase (TaKaRa ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Plant Biology 2024Quote: ... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
bioRxiv - Microbiology 2021Quote: ... pH 7.5) containing 3 % (w/v) skim milk powder and incubated with a rabbit anti-SLPMh 133-147 primary antibody (GenScript, Leiden, Netherlands), diluted 1:200 in TBS (10 mM TRIS ...
-
bioRxiv - Genomics 2024Quote: The 150-bp enhancer element containing either the reference or the alternative haplotype centred at rs62172376 was synthesized (GenScript Biotech, Piscataway, US) and cloned into empty pGL4.27 Firefly luciferase reporter (Promega ...
-
bioRxiv - Genetics 2024Quote: ... and bam 3’UTR by Genscript, Inc (Piscataway ...
-
bioRxiv - Cancer Biology 2020Quote: ... digested the vector with SpeI and SalI and introduced the following elements as a pre-synthetized stretch of DNA (GenScript®, Piscataway, NJ, USA): SpeI - SFFV - lox2272 - mtagBFP (iRFP720 ...
-
bioRxiv - Immunology 2022Quote: ... the SARS-CoV-2 reference strain Spike ectodomain sequence (amino acids 1-1208 derived from Genbank accession number MN908947) was codon-optimized for Chinese Hamster Ovary (CHO) cells and synthesized by GenScript (Piscataway, NJ, USA). Within the construct ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...