Labshake search
Citations for GenScript :
1 - 50 of 115 citations for Pig Hemoglobin HB CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Guinea pig anti- Runt was made by GenScript using the full-length protein as an antigen ...
-
bioRxiv - Developmental Biology 2021Quote: ... and guinea pig anti-Runt (1:600; GenScript). Rhodamine-phalloidin (Invitrogen R415 ...
-
bioRxiv - Developmental Biology 2023Quote: The guinea pig Zfh1 antibody was generated by GenScript. Recombinant antigen consisting of amino acids 648-775 of Zfh1 isoform PB was produced with an N-terminal His-tag used for purification ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA 3.1 (+)-PPARα and pcDNA 3.1 (+)-PPARβ/δ (pig sequence) were purchased from Genscript (Piscataway, NJ, USA). pCMV6-XL4-PPARγ (human sequence ...
-
bioRxiv - Genetics 2021Quote: ... rat anti-RAD-51 (1:500, (20)), guinea pig anti-SUN-1 S24pi (1:700, (72)), chicken anti-GFP (1:500, (A01694, Genscript)) ...
-
bioRxiv - Genetics 2023Quote: An antibody against CENP-C made in guinea pig was made by generating a clone expressing amino acids 502-939 (Genscript). This guinea pig anti-CENP-C was used at 1:1000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fusion protein MBP-Hyx 1-176 was purified and injected into guinea pigs and the antibodies generated were purified by GenScript (Hong Kong).
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Genomics 2023Quote: ... with CloneEZ PCR Cloning Kit (GenScript #L00339). The pLenti-GIII-EF1α-CBX3-Flag-HA ...
-
bioRxiv - Immunology 2023Quote: ... the commercialized ELISA kit (Genscript, Cat#L00871) was used ...
-
bioRxiv - Microbiology 2022Quote: The ToxinSensor Chromogenic LAL Endotoxin Assay kit (GenScript) was used to determine endotoxin units/mL of culture ...
-
bioRxiv - Neuroscience 2024Quote: ... a toxin Eraser endotoxin removal kit (#L00338, Genscript) with a high efficiency endotoxin removal resin was employed ...
-
bioRxiv - Neuroscience 2023Quote: ... using the High-Affinity Antibody Purification Kit (L00404, GenScript) following the manufacturer’s protocol.
-
bioRxiv - Bioengineering 2020Quote: ... and measured by ToxinSensor Chromogenic LAL Endotoxin Assay Kit (Genscript). The purified Nbs were further sterilized by passing a 0.2 μm filter (Millex ...
-
bioRxiv - Immunology 2020Quote: For the surrogate neutralization assay the cPass kit from GenScript was used (Cat ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... ToxinSensor Gel Clot Endotoxin Assay Kits were purchased from GenScript. VacciGrade LPS was purchased from InvivoGen.
-
bioRxiv - Microbiology 2021Quote: ... endotoxin was removed with the ToxinEraser™ Endotoxin Removal Kit (Genscript), and the endotoxin level was measured using the ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (Genscript ...
-
bioRxiv - Microbiology 2020Quote: ... or with the ONE-HOUR Western™ Standard Kit (Genscript, China).
-
bioRxiv - Immunology 2020Quote: ... were depleted of endotoxin with the ToxinEraser Endotoxin Removal kit (GenScript) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... generated using the GenCrispr sgRNA Screening Kit (L00689; Genscript Biotech Corp.), and diluted to a concentration of 4 uM ...
-
bioRxiv - Microbiology 2022Quote: ... Endotoxin levels were quantified using ToxinSensor™ Chromogenic LAL Endotoxin kit (GenScript) to ensure toxin purity.
-
bioRxiv - Neuroscience 2020Quote: ... with endotoxin levels determined using a LAL chromogenic endotoxin quantification kit (GenScript). Mouse or human α-synuclein fibrils were prepared by incubation of 7 mg ml -1 α-synuclein monomer of the same origin in phosphate-buffer saline for seven days at 37°C with constant agitation ...
-
bioRxiv - Microbiology 2021Quote: ... the cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (Genscript, L00847), was used as directed to detect antibodies that bind competitively to the receptor binding domain (RBD ...
-
bioRxiv - Biochemistry 2022Quote: The commercially available SARS-CoV-2 Neutralization Antibody Detection Kit (cPass, GenScript) was used to identify the presence of RBD neutralizing antibodies in the serum samples from mice immunized with r3CL-pro ...
-
bioRxiv - Developmental Biology 2022Quote: ... Inserts were ligated using GenBuilder™ Cloning Kit (Genscript, Piscataway NJ, USA) into pGL3-Basic (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... Endotoxin levels were determined using a LAL chromogenic endotoxin quantification kit (GenScript).
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit (GenScript, L00847-A) was used according to the manufacturer’s instructions as follows ...
-
bioRxiv - Microbiology 2020Quote: ... The remnant endotoxin was identified with ToxinSensorTM Chromogenic LAL Endotoxin Assay Kit (Genscript) and no more than 0.1 EU/mL of endotoxin was detected.
-
bioRxiv - Microbiology 2020Quote: Endotoxin of all purified proteins was removed with ToxinEraserTM Endotoxin Removal Kit (Genscript) in accordance to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit from GenScript (REF: L00847) was used according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... quantified using a chromogenic limulus amebocyte lysate endotoxin assay kit (GenScript, Piscataway, NJ), were significantly below those necessary for activation of TLR4 (typically <0.05 ng/ml).
-
Development of monoclonal antibody-based blocking ELISA for detecting SARS-CoV-2 exposure in animalsbioRxiv - Microbiology 2023Quote: ... A cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript, Piscataway, NJ) was used and the test was performed following the instructions of the manufacture ...
-
bioRxiv - Immunology 2023Quote: ... Endotoxin levels were measured using the ToxinSensor Chromogenic LAL Endotoxin Assay Kit (Genscript), according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Some recombinants were generated by homologous recombination using GenBuilder Kit (GenScript Biotech Corporation) following manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: ... and contaminants were removed by Toxin Sensor Chromogenic LAL Endotoxin Assay Kit (GenScript, L00350). Purified proteins were concentrated and filtered using Amicon ultra filter units – 30k NMWL (MilliporeSigma ...
-
bioRxiv - Immunology 2020Quote: ... Endotoxin concentration was determined using the ToxinSensorTM Chromogenic LAL Endotoxin Assay Kit (Genscript, NJ). All protein used for immunization had final endotoxin levels below 10 EU/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... monomers and LPS were detected using endotoxin detection kit following the manufacturer’s protocol (GenScript ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit) ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection of blot was carried out with a LumiSensorTM HRP Substrate Kit (GenScript Technology).
-
bioRxiv - Microbiology 2021Quote: ... All the proteins were endotoxin free (ToxinEraserTM Endotoxin Removal Kit, GenScript Biotechnology, Nanjing, China).
-
bioRxiv - Immunology 2021Quote: Competitive inhibition ELISA was performed using SARS-CoV-2 neutralization antibody detection kit (Genscript). The kit detects circulating neutralizing antibodies against SARS-CoV-2 that block the interaction between the receptor binding domains of the viral spike glycoprotein (RBD ...
-
bioRxiv - Neuroscience 2021Quote: ... The bacterial endotoxins were removed by Toxineraser endotoxin removal kit (GenScript Biotech Corp., USA) followed with the measurement of the level of endotoxin by ToxinSensor Chromogenic LAL Endotoxin Assay Kit (GenScript Biotech Corp. ...
-
bioRxiv - Molecular Biology 2021Quote: The SARS-CoV-2 surrogate virus neutralization test (sVNT) kit was obtained from GenScript Inc ...
-
bioRxiv - Cell Biology 2023Quote: ... Blots were developed using the Lumi Sensor Chemiluminescent HRP Substrate kit (Genscript, United States) and SuperRX Fuji medical X-Ray films (Fuji FILM ...
-
bioRxiv - Genetics 2024Quote: ... and cloning into the pJR1-41XL vector116 with the CloneEZ PCR Cloning Kit (GenScript). Plasmids were checked by PCR for correct insert size and also by Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Bioengineering 2019Quote: Endotoxin amounts were tested using the ToxinSensor chromogenic LAL endotoxin assay kit (GenScript, Piscataway, NJ) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... and checked for endotoxins levels using the ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript).