Labshake search
Citations for GenScript :
1 - 50 of 158 citations for PD L1 Cynomolgus HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Cancer Biology 2020Quote: ... the PD-L1-lnc shRNA vectors were synthesized and then cloned into pLKO.1 vector (GenScript, China). The siRNA target sequences were listed in table S3 ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full-length cDNA of PD-L1-lnc was synthesized and cloned into pcDNA3.1-P2A-eGFP vector (GenScript, China). To suppress PD-L1-lnc ...
-
bioRxiv - Immunology 2022Quote: ... using eBlot L1 (GenScript). Membranes were blocked and stained with primary antibody overnight in 5% nonfat dry milk in 0.1% PBST ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were transferred to PVDF membranes with the eBlot® L1 system using eBlot® L1 Transfer Stack supports (Genscript) and the resulting membranes were washed three times with TBS-T (Tris-buffered saline containing 0.1 % Tween® 20 (Merk)) ...
-
bioRxiv - Cell Biology 2021Quote: ... Gels were transferred through eBlot L1 (GenScript L00686) onto nitrocellulose membranes (BioRad 1620112) ...
-
bioRxiv - Microbiology 2021Quote: ... eBlot L1 –Fast Wet Protein Transfer System (GenScript) was used for blotting and proteins were stained using the following antibodies ...
-
bioRxiv - Immunology 2021Quote: ... nonreducing gels and transferred using eBlot L1 Transfer system (GenScript). Blots were blocked in 5% Bovine Serum Albumin (BSA ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the eBlot™ L1 Fast Wet Transfer System (GenScript) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... using an eBlot™ L1 wet transfer (GenScript Biotech, China). Membranes were blocked and incubated with primary antibodies and secondary antibodies using eZwest Lite Automated Western Device (GenScript Biotech ...
-
bioRxiv - Genomics 2021Quote: ... human Hek293 DNA was purchased from Genscript. S ...
-
bioRxiv - Zoology 2020Quote: ... Gels were stained with Coomassie brilliant blue using eStainTM L1 (Genscript).
-
bioRxiv - Cell Biology 2022Quote: ... Protein was transferred to a PVDF membrane using eBlot L1 (Genscript). Blocking was performed with 5% milk in PBST (PBS + 0.1% TritonX-100 ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by staining using the eStain L1 Protein Staining System (GenScript). PAGE-MASTER Protein Standard Plus (GenScript ...
-
bioRxiv - Microbiology 2020Quote: ... 50 ng of His-tagged RBD (His-RBD, aa 319-541) (Genscript) was then added to each well and incubated at 37°C for 2 hours ...
-
bioRxiv - Biochemistry 2022Quote: ... anti-His tag (Genscript) or anti-FLAG (Genscript ...
-
bioRxiv - Cell Biology 2021Quote: The antibodies used were: monoclonal anti-His THE HIS Tag (GenScript, Piscataway, NJ); monoclonal anti-HA (BioLegend ...
-
bioRxiv - Immunology 2022Quote: His tag-IP was performed using anti-His affinity resin (GenScript L00439-1) and Myc tag-IP was performed using anti-Myc affinity resin ...
-
bioRxiv - Microbiology 2021Quote: ... Anti-His-HRP (Genscript, A00612), Avidin-HRP (Biolegend ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-His-HRP (Genscript, A00612), Avidin-HRP (Biolegend ...
-
bioRxiv - Microbiology 2023Quote: ... anti-His (1:4,000) (GenScript), anti-GFP (1:10,000 ...
-
bioRxiv - Biochemistry 2024Quote: ... His-tagged Enterokinase (Z03004, Genscript) was added to the dialyzed ...
-
bioRxiv - Plant Biology 2021Quote: ... using a highly efficient wet protein transfer system (eBlot L1; GenScript, Nanjing, China). The membranes were blocked for 2 h at room temperature in TBST solution (2 mM This-HCl ...
-
bioRxiv - Plant Biology 2023Quote: ... and transferred to PVDF membrane using an eBlot™ L1 transfer system (GenScript). The target proteins were probed with corresponding antibodies.
-
bioRxiv - Synthetic Biology 2020Quote: ... The His-tagged GMCSF peptide was quantified using a His Tag ELISA Detection Kit (GenScript) according to the provided protocol and 5-10 fold dilutions of frozen samples.
-
bioRxiv - Microbiology 2021Quote: ... His-tagged AtxA was detected using anti-His antibody (GenScript USA Inc., Piscataway, NJ, USA). RNA polymerase subunit β was used as a loading control and detected using anti-RNAP antibody (Thermo fisher ...
-
bioRxiv - Plant Biology 2022Quote: ... His-FmASP protein was detected by immunoblotting with using a mouse anti-His antibody (GenScript, A00186). The immunoblotting band signals were visualized by enhanced enhanced chemiluminescence (ECL ...
-
bioRxiv - Microbiology 2020Quote: ... THE™ Anti-His-HRP (Genscript).
-
bioRxiv - Plant Biology 2023Quote: ... Hexa-His peptide (Genscript, Inc., NJ) was used as a control ...
-
bioRxiv - Microbiology 2023Quote: ... An unconjugated Anti-HIS antibody (Genscript) was added (5.0 mg/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... The pESC-HIS-hMfsd7c plasmid (Genscript) was used for overexpression on the yeast S ...
-
bioRxiv - Plant Biology 2022Quote: ... Sample in the gel were transferred to PVDF membrane using eBlot™ L1 (GenScript Corporation). Anti-HA (1:5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... whereas all other gels were stained using the eStain™ L1 protein staining system (GenScript). Precision Plus Protein™ standards (Bio-Rad Laboratories ...
-
bioRxiv - Bioengineering 2022Quote: ... A mouse anti-His-Tag antibody (GenScript) was diluted 1:100 and used as the primary antibody ...
-
bioRxiv - Microbiology 2024Quote: ... using anti-His (mouse) primary antibody (GenScript) at a dilution of 1:3,000 ...
-
bioRxiv - Biochemistry 2023Quote: The genes encoding full-length TcdB toxin variants (TcdB1,3 and 4) were synthesized with a C-terminal His-tag and cloned into pC-His 1622 by Genscript. The pC-His1622 vector was purchased from MoBiTec ...
-
Sterilizing immunity against SARS-CoV-2 in hamsters conferred by a novel recombinant subunit vaccinebioRxiv - Microbiology 2020Quote: ... Coomassie brilliant blue staining for SDS-PAGE were performed using eStain L1 Protein Staining machine (Genscript). Gels for western blot were transferred onto the nitrocellulose membrane and reacted with COVID-19-convalescent serum (1:500 diluted) ...
-
bioRxiv - Plant Biology 2019Quote: ... HIS-TAN1 and HIS-TAN1-GFP concentrations were checked with a BCA protein assay (Genscript Corp Piscataway, New Jersey USA). After refolding ...
-
bioRxiv - Synthetic Biology 2022Quote: ... linker with both N-terminal and C-terminal 10×His-tags with a cysteine adjacent to each 10×His tag in a pET21b vector (Genscript). The plasmid was transformed into T7 express cells (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... The successful removal of His-tag was validated by western blot using the anti-His-tag antibody (Genscript, A00186-100).
-
bioRxiv - Bioengineering 2020Quote: ... HRP-conjugated secondary antibodies against His-tag (Genscript) were diluted 1:5,000-10,000 and incubated with the well for 1 hr at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse α-His antibody (1:1000, Genscript A00186) in TBST buffer with 0.5% BSA and goat α-mouse IgG (H+L ...
-
bioRxiv - Plant Biology 2022Quote: ... specific rabbit His-tag antibody (GenScript, A00174-40) or anti-monoubiquityl-histone H2B (Lys-120 ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA from the HEK293 cell line was purchased from GenScript (https://www.genscript.com).xs
-
bioRxiv - Biochemistry 2023Quote: ... or proteins were transferred to PVDF membranes using an eBlot L1 protein transfer system (GenScript, Piscataway, NJ) and used for immunoblotting.
-
bioRxiv - Biophysics 2020Quote: ... To determine the binding affinities between antigens and antibody mouse monoclonal anti-His-tag IgG (clone 6G2A9, The™ His tag Ab, GenScript) was captured on the surface of active flow cell to the level of 100-200 RU ...
-
bioRxiv - Biochemistry 2023Quote: ... Equilibrated Ni-NTA resin was added to the products to bind the MBP-His tag and the His-tagged TEV protease (Genscript, Cat. # Z03030) while allowing the purified FAM210A-dMTS cleaved product to be collected in the flowthrough ...
-
bioRxiv - Synthetic Biology 2023Quote: The expression levels of his-tagged nanobodies resulting from microfermentations were quantified using the His tag ELISA detection kit (GenScript, Cat# L00436) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 1:200 iFluor647-conjugated mouse anti-His (Genscript A01802) for civet ACE2 ...
-
bioRxiv - Biochemistry 2020Quote: ... and Western blot analysis using anti-His (A01620, Genscript) and anti-PSA-NCAM (MAB5324 ...