Labshake search
Citations for GenScript :
501 - 550 of 818 citations for PAK4 5 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... This polyclonal antibody was raised in rabbits against a synthetic peptide (CKTYLGRPWKEYSRT) (Genscript, Piscataway, NJ, USA) that includes the highly conserved amino acid sequence including residue in the catalytic site of PMEs (Markovič and Janeček ...
-
bioRxiv - Cell Biology 2021Quote: KLC1D/E synthetic peptides used for CD or NMR measurements were purchased from Genscript (>98% purity). Sequences were as follows ...
-
bioRxiv - Cell Biology 2021Quote: WIPI2d10-364Δ263-295: ATG16L1 (207-230) complex was formed overnight with 5X molar excess peptide (GenScript). Crystals of the complex were grown using hanging drop vapor diffusion method at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... P-factor (TYADFLRAYQSWNTFVNPDRPNL) and α-factor (WHWLQLKPGQPMY) (Custom Peptide Synthesis, 4 mg, ≥95% purity, GenScript Biotech) were dissolved in DMSO to a concentration of 10 mM ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-CCHa1 (Our lab raised antibodies against the peptide QIDADNENYSGYELT 68, Genscript, 1:50 dilution). Secondary antibodies used ...
-
bioRxiv - Biophysics 2021Quote: ... These peptide films were then dissolved according to their hydrophobic character and solvent recommended by GenScript and Thermo Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Each 7-mer D-peptide with an N-terminal cysteine was synthesized by GenScript (Piscataway, NJ). Peptides were conjugated with IRDye 800CW maleimide (Li-Cor ...
-
bioRxiv - Immunology 2021Quote: ... human recombinant IL-2 (10 U/well) and with or without NP311 or NP366 peptides (Genscript) at 0.2ug/ml ...
-
bioRxiv - Biophysics 2019Quote: A synthetic peptide from CPSF6 comprising residues 313-327 with a C-terminal cysteine (PVLFPGQPFGQPPLGC, Genscript) was dissolved (1.85 mM ...
-
bioRxiv - Biochemistry 2021Quote: ... coli PcoB including its signal peptide (UniProt Accession No.Q47453) was codon optimized and synthesized by Genscript. A 6xHis tag followed by a TEV cleavage site was introduced between S26 and V27 by overlap PCR to facilitate protein purification ...
-
bioRxiv - Immunology 2021Quote: ... A peptide representing the mouse ANGPTL4 amino acids 29-53 (29QPEPPRFASWDEMNLLAHGLLQLGH53) was also synthesized by Genscript) with the same C-terminal-GGGC modification ...
-
bioRxiv - Biophysics 2022Quote: ... The target protein complexes were eluted twice with 500 μg/ml 3× DYKDDDDK peptide (RP21087, GenScript) dissolved in the wash buffer ...
-
bioRxiv - Immunology 2022Quote: RMA-S/HLA-E cells were incubated with serial dilutions of peptides (3-300 μM, Genscript) in OptiMEM (ThermoFisher ...
-
bioRxiv - Biochemistry 2023Quote: N-terminally biotinylated synthetic MUC1 peptide with the sequence biotin-GGS-APDTRPAPG was ordered from Genscript. This was dissolved in PBS and printed on a planar streptavidin-coated SPR chip (P-Strep ...
-
bioRxiv - Biophysics 2023Quote: The ORF6-CTR peptide with sequence 38-KNLSKSLTENKYSQLDEEQPMEID-61 was commercially synthesized and obtained from Genscript LLC ...
-
bioRxiv - Microbiology 2023Quote: ... a custom-synthetized N-terminally biotinylated peptide comprising residues Met1 to Gln38 of LmdC (GenScript, USA) was immobilized on the biosensors ...
-
bioRxiv - Biochemistry 2023Quote: ... The synthesis of the surrogate peptides both labeled and unlabeled was done by GenScript (Piscataway, NJ) and provided in lyophilized form.
-
bioRxiv - Biochemistry 2023Quote: A 27 amino acid peptide containing amino acids 340-366 of RAD18 was purchased from GenScript and used at 200 µM for ITC binding experiments ...
-
bioRxiv - Biochemistry 2024Quote: Acetylated and fluorescein (FITC)-labeled tau peptides for crystallography and fluorescence anisotropy were purchased from GenScript (sequence ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Biophysics 2022Quote: ... Protein was eluted by incubation with 3 BVs elution buffer (wash buffer supplemented with either 3C protease (1:10 w:w 3C:ABCA7) or 0.5 mg ml-1 1D4 peptide (GenScript)) for 2-18 hours.
-
bioRxiv - Molecular Biology 2020Quote: Specific treatment conditions were as follows: GPCR activation – Cells were treated with α-factor peptide hormone (Genscript) at 3μM final concentration ...
-
bioRxiv - Biophysics 2019Quote: ... TRPV2 was eluted with Wash Buffer containing 0.006% DMNG and 3 mg/ml 1D4 peptide (GenScript USA) and subjected to size-exclusion chromatography using a Superose 6 column (GE Healthcare ...
-
bioRxiv - Biochemistry 2021Quote: All peptides (see all sequences in Supplementary Tables 1) were purchased at 95% purity (Genscript, Leiden, Netherlands). NAD was purchased from Roche (Basel ...
-
bioRxiv - Biochemistry 2021Quote: Purified PX domain was specifically labeled on its N-terminal glycine with a FITC-LPETGG peptide (Genscript) in a Sortase-mediated reaction according to the protocol described in (Theile et al ...
-
bioRxiv - Biochemistry 2022Quote: ... A peptide corresponding to the human CRX homeodomain (amino acids 39 to 98) was synthesized by Genscript.
-
bioRxiv - Biochemistry 2022Quote: The 10 C-terminal residues of Caulobacter crescentus RNase E (EKPRRGWWRR) (GWW peptide) were synthesized by GenScript with C-terminal amidation and dissolved in Milli-Q water ...
-
bioRxiv - Neuroscience 2021Quote: ... these cells were cultured in the presence of the OVA257-264 peptide (GenScript RP10611 or Sigma S7951). After 12 hours ...
-
bioRxiv - Immunology 2020Quote: Synthetic peptides were generated by Fmoc (9-fluorenylmethoxy carbonyl) chemistry to a purity of 85% by Genscript USA ...
-
bioRxiv - Biochemistry 2021Quote: The tetramethylrhodamine (TMR) labeled peptide with sequence Gly-Gly-GLy-Ser-{Lys-(TMR)}was purchased from Genscript. Its mass ...
-
bioRxiv - Biochemistry 2021Quote: ... MHC tetramers29 were synthesized by the NIH Tetramer Core Facility (Atlanta, GA) using custom peptides from GenScript. The peptide sequences are SIINFEKL (OVA) ...
-
bioRxiv - Immunology 2021Quote: ... Synthetic cDNAs encoding the heavy chains and light chains of H5.31 and H5.28 Fabs were synthesized and cloned into pcDNA3.1 (+) downstream of the CD5 signal peptide (Genscript). Expi293F cells were transfected transiently with pcDNA3.1 (+ ...
-
bioRxiv - Immunology 2021Quote: ... All other peptides were 13 amino acids overlapping by 11 amino acids and were synthesized by GenScript. The peptides covering the envelope (E) ...
-
bioRxiv - Immunology 2022Quote: The spike – S1 peptide pools of Wuhan wild-type SAR-CoV2 were purchased from Genscript (cat # RP30027). The Peptivator peptide pools for the variant of concerns and B ...
-
bioRxiv - Biochemistry 2023Quote: ... and H2A.Z N-terminal tail peptides with and without modifications were purchased from GenScript (Piscataway, NJ, USA). Amino-acid sequence information of each peptide is available in Table 1 ...
-
bioRxiv - Biophysics 2023Quote: ... NTS1 peptide encompassing the first 16 residues of its CTD (SANFRQVFLSTLACLC) purchased from from GenScript (>= 95% purity) was dissolved in 100% trifluoroethanol (TFE ...
-
bioRxiv - Cell Biology 2023Quote: ... and the cyclic-retro-inverse-vasoinhibin-(45–51)-peptide (CRIVi45–51) were synthesized by GenScript (Piscataway, NJ). Recombinant vasoinhibin isoforms of 123 (Vi1-123 ...
-
Structural insight into guanylyl cyclase receptor hijacking of the kinase–Hsp90 regulatory mechanismbioRxiv - Biochemistry 2023Quote: ... The protein complex was eluted with the addition of 200 μg/mL of FLAG peptide (DYKDDDD) (GenScript). Protein was subsequently concentrated to >2 mg/mL and used for cryo-EM imaging.
-
Exploring the Role of Spatial Confinement in Immune Cell Recruitment and Regeneration of Skin WoundsbioRxiv - Bioengineering 2023Quote: ... and crosslinked at a 0.6 VS to thiol ratio with di-thiol matrix metalloproteinase sensitive peptide (GenScript) plus 10 μM AlexaFluor-647 (ThermoFisher) ...
-
bioRxiv - Bioengineering 2023Quote: ... plantarum NCIMB8826 strain harboring helper plasmid pLH01 was induced with 100 ng/ml Sakain P peptide (GenScript) for RecE/T expression and was subsequently prepared as competent cells ...
-
bioRxiv - Immunology 2023Quote: ... DCs were isolated with CD11c+ Microbeads (Miltenyi) per manufacturer’s instructions then pulsed with DbGP33- 41 peptide (0.1μM, GenScript) in cRPMI for 30 minutes at 37°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... SpyTag peptide (N-term-AHIVMVDAYKPTKGSGDRCG-C-term, N-term: Acetylation, C-term: Amidation, purity: 94%, GenScript Biotech) was dissolved in triethanolamine (TEA ...
-
bioRxiv - Immunology 2023Quote: ... Peptides TAT-HKII (MIASHMIACLFTELN(β-Ala)GYGRKKRRQRRG-amide) and TAT (GYGRKKRRQRRG-amide) were custom-made by GenScript.
-
bioRxiv - Microbiology 2023Quote: ... gH was detected using custom-made polyclonal rabbit antibodies raised against peptides derived from KSHV gH (Genscript).
-
KNL1 and NDC80 represent new universal markers for the detection of functional centromeres in plantsbioRxiv - Genetics 2023Quote: ... immunization of rabbits and peptide affinity purification of antisera were performed by GenScript (KNL1; Piscataway, NJ, USA) and Biomatik (NDC80 ...
-
bioRxiv - Biochemistry 2023Quote: The surrogate peptides having labeled lysine (13C6 15N2) or labeled arginine (13C6 15N4) were synthesized by GenScript to a purity of more than 98% and supplied in a lyophilized form ...
-
bioRxiv - Microbiology 2024Quote: ... The EspE antibody (1:5,000 dilution) was a custom rabbit polyclonal antibody against the CGQQATLVSDKKEDD peptide (Genscript).
-
bioRxiv - Bioengineering 2024Quote: ... Dicysteine peptide Ac-GCRDLPESGGPQGIWGQDRCG-NH2 (4S9 degradable sequence, MMP-degradable sequence) was purchased from Genscript (Piscataway, NJ), resuspended in 10% glacial acetic acid ...