Labshake search
Citations for GenScript :
101 - 150 of 438 citations for P450 Demethylation Activity Kit 2 plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... An anti-SARS-2 nucleocapsid protein rabbit antiserum (generated by GenScript) was used at a 1:1000 dilution to detect specific anti–SARS-2 immunoreactivity using the Discovery ULTRA automated staining instrument (Roche Tissue Diagnostics ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein-crud (RP30020, GenScript Biotecn Corp). A ten amino acid overlapping peptide mixture pool was prepared ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 spike gene (Wuhan) was synthesized by Genscript for Dr ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 N and S1 proteins were obtained from Genscript and Sino Biological.
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 2 mL of nickel resin (GenScript) at RT for 20 minutes and washed once with lysis buffer and another three times with wash buffer (20 mM Tris-Cl pH8.8 ...
-
bioRxiv - Immunology 2019Quote: 96-well ELISA plates were coated overnight at 4°C with mouse anti-Avi-tag antibody (Genscript) at 2 μg/ml in PBS ...
-
bioRxiv - Immunology 2023Quote: ... Plates were coated with 500 ng/mL RBD or 1 μg/mL NP (GenScript, Piscataway, New Jersey), and heat-inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... Antagonist peptide 1 (SCSLFTCQNGIV) and 2 (SCSLFTCQNGGGWF) were chemically synthesized by Genscript. Anti-Mouse-IgG (H&L ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant SARS-CoV-2-RBD (T80302) was obtained from Genscript (NanJing, China). Antagonist peptide 1 (SCSLFTCQNGIV ...
-
bioRxiv - Systems Biology 2019Quote: ... half of the cells were stimulated with erythropoietin (2 ng/mL; GenScript) 24 hours after transfection ...
-
bioRxiv - Immunology 2022Quote: ... 2) TCRα-CD3δ crosslinking: rabbit anti-cMyc and mouse anti-FLAG (Genscript); 3 ...
-
bioRxiv - Immunology 2021Quote: A monoclonal anti-SARS-CoV-2 RBD capture antibody (GenScript, Cat# 5B7D7) was coated on Nunc Maxisorp ELISA plates (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... An anti-SARS-CoV-2 Spike monoclonal neutralizing antibody (GenScript, Cat# 6D11F2) was used as a positive control ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2-RBD-his protein was purchased from GenScript (GenScript, Nanjing), and GPC5-his protein was purchased from R&D (Minneapolis ...
-
bioRxiv - Immunology 2022Quote: ... A SARS-CoV-2 neutralizing monoclonal antibody (mAb; GenScript, Piscataway, NJ; #A02057), was used as a positive control at a known starting concentration of 3.2 ng/µL followed by serial 1:2 dilutions similarly to each sample and negative control ...
-
bioRxiv - Microbiology 2020Quote: ... and SARS-CoV-2 spike protein (ECD, His & Flag Tag) (GenScript Z03481). Proteins were biotinylated using EZ-Link™ Sulfo-NHS-Biotin ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Immunology 2021Quote: ... and B.1.617.2+ SARS-CoV-2 RBD construct were synthesized by GenScript into pCMVR with an N-terminal mu-phosphatase signal peptide ...
-
bioRxiv - Immunology 2022Quote: ... 2 µg/ml MHC-I binding SIINFEKL peptide (ovalbumin 257-264, GenScript), or 2 µg/ml ISQAVHAAHAEINEAGR MHC-II binding peptide (ovalbumin 323-339 ...
-
bioRxiv - Neuroscience 2023Quote: The riboprobes were synthetized from 2 clones that were purchased from Genscript or obtained by BBSRC ChickEST Database (Boardman et al. ...
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Biochemistry 2019Quote: ... The gene encoding NB4 mutant 2 (L13S, Q15D, K45D, K66D) was synthesised (GenScript), amplified and cloned into the pHEN6c expression vector ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Immunology 2020Quote: The SARS-CoV-2 RBD (BEI NR-52422) construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag (GHHHHHHHH) ...
-
bioRxiv - Biophysics 2022Quote: ... for 2 minutes followed by 20 μM biotinylated FLAG-tag antibody (A01429, GenScript) for 30 minutes ...
-
bioRxiv - Immunology 2020Quote: DNA encoding SARS-Cov-2 RBD (residues 319-541) was gene synthesized (Genscript) and cloned into pCEP4 mammalian expression vector with a N-terminal IgG leader sequence and C-terminal Avitag and His tag ...
-
bioRxiv - Immunology 2020Quote: ... DNA encoding the SARS-Cov-2 RBD (residues 331-527) was synthesized (Genscript) with a C-terminal His6 purification tag and cloned into a CMVR plasmid ...
-
bioRxiv - Immunology 2020Quote: ... The plasmid encoding for SARS-CoV-2 S RBD was synthesized commercially (Genscript). The RBD sequence (encoding for residues 319-541 ...
-
bioRxiv - Physiology 2021Quote: ... PC-1 and PC-2 coiled-coil domain peptides were custom-made (Genscript). PC-1 or PC-2 peptides were added to pipette solution immediately before use at a final concentration of 1 μM ...
-
bioRxiv - Microbiology 2021Quote: ... codon-optimized SARS-CoV-2 ORF3 and E genes were synthesized by GenScript Biotech (Piscataway ...
-
bioRxiv - Molecular Biology 2021Quote: The SARS-CoV-2 RBD (BEI NR-52422) construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag (GHHHHHHHH) ...
-
bioRxiv - Immunology 2022Quote: ... The SARS-CoV-2 spike glycoprotein expression constructs were synthesized by GenScript (Netherlands). Constructs bore the following mutations relative to the Wuhan-Hu-1 sequence (GenBank ...
-
bioRxiv - Immunology 2022Quote: ... or 2 µg/ml ISQAVHAAHAEINEAGR MHC-II binding peptide (ovalbumin 323-339, GenScript) was added ...
-
bioRxiv - Microbiology 2022Quote: The SARS-CoV-2 Wuhan-Hu-1 RBD construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Molecular Biology 2022Quote: The sequence for Rab7A (residues 2-176, uniprot P51149) was purchased from Genscript, N-terminally fused to a His tag and tobacco etch virus (TEV ...
-
bioRxiv - Biophysics 2023Quote: ... The expression clone of ppSUMO-2_SARS-CoV-2 NSP16 was obtained from Genscript. Expression was carried out in E ...
-
bioRxiv - Immunology 2022Quote: DNA encoding SARS-Cov-2 RBD (residues 319-541) was gene synthesized (Genscript) and cloned into the pCEP4 mammalian expression vector (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: Full-length SARS-CoV-2 S gene (GenBank: NC_045512.2) was synthesized by Genscript. as human codon-optimized cDNAs ...
-
bioRxiv - Immunology 2022Quote: ... total splenocytes were seeded at 0.5×106 cells per well in a 24-well plate and stimulated with 0.1 μM OVA257-264 (Genscript RP10611) peptide and 20 ng/ml recombinant murine interleukin-2 (IL-2 ...
-
bioRxiv - Immunology 2022Quote: ... 2 × 106 splenocytes from each animal were transferred in a round bottom 96 well plate (200 µl volume) and ex vivo restimulated with 1 µg/ml of the lmon_0149 peptides YSYKFIRV (GenScript) and QVFEGLYTL (made in house by solid phase synthesis ...
-
bioRxiv - Immunology 2023Quote: ... 5×105 cells per well (6 well plate) were stimulated with 100 ng/mL of IFN-γ (Z02916, Genscript) for 0 h ...
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Immunology 2021Quote: ... Specific anti-CoV immunoreactivity was detected using a SARS-CoV-2 nucleoprotein antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... 293T cells were transiently transfected with plasmids expressing SARS-CoV-2 spike protein (GenScript MC_0101081 ...
-
bioRxiv - Immunology 2021Quote: ... Enriched B cells were stained with Flag tagged SARS-CoV-2 spike (Genscript, Z03481) then incubated with APC conjugated anti-Flag and PE conjugated anti-Flag for double staining ...