Labshake search
Citations for GenScript :
551 - 600 of 837 citations for Nipah Virus Glycoprotein F Recombinant Protein Human Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: The C-terminally His-tagged construct encoding human UGGT1 residues 43-1551 was PCR-amplified from the commercially sourced vector UGGT1-pUC57 (GenScript) with primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... The coding sequences of human UBXN1 (Uniprot identifier Q04323-1) and FAF2 (Uniprot identifier Q96CS3-1) were synthesized by GenScript Biotech ...
-
bioRxiv - Microbiology 2020Quote: The IgG heavy and light chain variable genes of CB6 mAb (GenBank: MT470196 and MT470197) were human codon-optimized and synthesized by Genscript and cloned into antibody expression vectors.
-
bioRxiv - Systems Biology 2020Quote: Clones were either collected from the human Orfeome 3.1 and 8.1 clone libraries (full length clones) or ordered as synthetic genes from Genscript (RBP constructs). As in our previous work (Jolma et al ...
-
bioRxiv - Microbiology 2021Quote: ... RBD-binding peptide SBP1 derived from human ACE2 α helix 1 (Ac-IEEQAKTFLDKFNHEAEDLFYQS-NH2) was synthesized by GenScript (Nanjing, China).
-
bioRxiv - Immunology 2022Quote: ... Bound IgG was detected as the luminescence signal at 425 nm using an HRP-conjugated anti-human IgG (H&L) secondary antibody (Genscript) and SuperSignal ELISA Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific).
-
bioRxiv - Biophysics 2020Quote: ... The plasmid encoding full-length human DAP5 with an N-terminal 6x-histidine tag was purchased from Genscript (Piscataway, NJ). All the proteins were recombinantly expressed in E ...
-
bioRxiv - Neuroscience 2019Quote: ... The following reagents or cell lines were used in this study: a human Aβ42 peptide (GenScript, Nanjing, China, cat# RP10017), the Dicer1 siRNA duplex and the negative control (NC ...
-
bioRxiv - Immunology 2020Quote: ... Genes for expression of HA fusions to nanoparticle trimeric components were codon optimized for expression in human cells and cloned into the CMV/R (VRC 8400) mammalian expression vector by Genscript. All HA fusions to the I53_dn5B trimer contained full-length HA ectodomains including native secretion signals ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Human CLEC16A C-terminal Flag epitope-tagged full-length or alternatively spliced disease isoform vectors (Genscript; OHu18264D and OHu02258D). Constructs containing CLEC16A ΔC (1-892 only ...
-
bioRxiv - Biophysics 2022Quote: ... coli optimized codons for the C0-C2 portion of human cMyBP-C with N-terminal 6x His tag and TEV protease cleavage site were obtained from GenScript. C0-C2 mutants were engineered using a Q5 Site-Directed Mutagenesis Kit (New England Bio Labs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... A human SCAPER cDNA construct with C-terminal FLAG-tag in a pcDNA3.1 vector was obtained from Genscript (cloneID OHu03552) and subsequently cloned into pcDNA5/FRT/TO vectors with N- or C-terminal FLAG-tags ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This gene was codon optimized for human cell expression and made in the CMV/R mammalian expression vector by Genscript. Transient transfection into HEK293F cells was carried out using PEI MAX ...
-
bioRxiv - Immunology 2022Quote: ... The antibody expression constructs containing the heavy-chain and the light-chain variable region exons, with human constant region sequences (IgG1, Igκ) at the C terminus were made by Genscript. Monoclonal antibodies were generated using the Expi293 expression system (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: S- and MB-COMT cDNA were codon optimised for expression in human cells and inserted into an integrative VAMP-seq expression vector (Matreyek et al., 2018) fused to GFP (Genscript). Singlesite variants were generated by Genscript ...
-
bioRxiv - Biochemistry 2023Quote: ... was inserted into the N-terminus of human AGO2 using CRISPR/cas9 in WT HCT116 cells carried out by GenScript. The SV40 NLS amino acid sequence is PKKKRKVAG ...
-
bioRxiv - Cell Biology 2023Quote: ... residues 1-77) and human STX4 (lacking the transmembrane domain; residues 1-271 with 272C) were generated as synthetic genes (Genscript) with codon optimization for human expression ...
-
bioRxiv - Cell Biology 2023Quote: DNA sequences that encode the wildtype amino acid sequence of human ABHD17B and encode a mutation of Ser 170 to Ala in ABDH17B were synthesized by GENScript. The cDNAs also contain identical additional nucleotide modifications that do not affect amino acid sequence (Supplementary Fig ...
-
bioRxiv - Immunology 2023Quote: Antibody binding was also assayed by flow cytometry using CHO-K1 and CHO-K1 Fut8 KO cells transfected with a human PD-1 plasmid (GenScript) by lipofectamine (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The cDNA of pMag, pbF, and Dkk1c (the C-terminal domain of human Dkk1, residues 177-266) were synthesized by Genscript. The plasmid constructs pMag-pbF and RRP-Dkk1c ...
-
bioRxiv - Biochemistry 2023Quote: Human full-length wild-type DNA Pol β was overexpressed from a PET-28a codon optimized clone purchased from GenScript in the BL21-CodonPlus(DE3)-RP E ...
-
bioRxiv - Cell Biology 2023Quote: All constructs for human expression were generated through custom synthesis and subcloned into a pcDNA3.1 backbone by Genscript (Piscataway, USA). All constructs for GFP expression in E ...
-
bioRxiv - Immunology 2023Quote: ... and were codon-optimized for human cell expression and made in the CMV/R vector (Barouch et al. 2005) by Genscript with a C-terminal hexahistidine affinity tag ...
-
bioRxiv - Biochemistry 2023Quote: The DBC1-NHD fragment (residues 354-396) derived from the human DBC1 (Uniprot code: Q8N163) was synthesized and subsequently cloned into the pETM41 vector by GenScript Biotechnology Co. ...
-
bioRxiv - Biochemistry 2023Quote: The full-length cDNAs for human SIDT1 and SIDT2 (Uniport: Q9NXL6 and Q8NBJ9, respectively) were codon-optimized and synthesized by GenScript Co. ...
-
bioRxiv - Immunology 2023Quote: DNA fragments that encode SARS-CoV-2 variant RBD (Spike 319-541) were codon-optimized for human cell expression and synthesized by Genscript. His-AVI tags were added at the end of the fragments ...
-
bioRxiv - Biochemistry 2023Quote: Human Mint1 sequences for bacterial expression were codon optimised and sub-cloned into the pGEX4T-2 plasmid by Genscript (USA). The constructs generated were GST-tagged Mint1(226- 314)(MID) ...
-
bioRxiv - Biochemistry 2024Quote: ... the RBD and subdomain-1 (RBD-SD1, residues 307-675) and human TMPRSS2 (residues 107-492, NCBI accession O15393) were obtained from Genscript. Cloning and mutagenesis of those genes were also performed by Genscript ...
-
bioRxiv - Biophysics 2023Quote: The codon optimized gene encoding full length human systemic RNAi-defective transmembrane family member 1 (hSIDT1) was synthesized by GenScript and was then cloned into the pEG BacMam expression vector to be expressed via baculoviral transduction in HEK293S GnTI− cells as a fusion protein containing a C-terminal GFP-Strep-tag-II for large scale protein expression [49] ...
-
bioRxiv - Cell Biology 2024Quote: ... (Biotin-GRMTNGAMNVEIGNPTYKMYEGGEPDDG) and LRP1 (NPXA) (Biotin-GRMTNGAMNVEIGNPTAKMYEGGEPDDG) peptides corresponding to human LRP1 amino acid residues 4458-4483 were purchased from GenScript and ...
-
bioRxiv - Biophysics 2024Quote: ... A pET28a(+) plasmid containing an open reading frame for human hnRNPA1 with an N-terminal 6xHis tag was synthesized by GenScript. The 6xHis-hnRNPA1 was expressed in E ...
-
bioRxiv - Molecular Biology 2020Quote: ... The protein complexes were detected by western blot with anti-His antibody (Genscript, A00186) and anti-Flag antibody (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: The proteins were codon optimized for eukaryotic expression and de novo synthesized by GenScript.
-
bioRxiv - Plant Biology 2019Quote: ... 1:500 (produced for this study using full length protein as antigen by GenScript); α-Actin ...
-
bioRxiv - Biochemistry 2020Quote: ... 293T cells were transiently transfected with plasmids expressing SARS-CoV-2 spike protein (GenScript MC_0101081 ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV-2 Spike protein (S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ) was added at concentrations ranging from 0.07 to 500 to nM ...
-
bioRxiv - Cell Biology 2021Quote: ... 25 μg protein from each sample was mixed with LDS Sample Buffer (M00676, GenScript) and loaded in each well of a 4-20% SurePAGE™ Bis-Tris gel (M00656 ...
-
bioRxiv - Bioengineering 2022Quote: We obtained the genes encoding the designed proteins in pET28a vectors from GenScript (Genscript.com). We confirmed the sequences of all the constructs by DNA sequencing (Eton bioscience ...
-
bioRxiv - Plant Biology 2019Quote: ... SlMai1-myc or synSlMai1-myc proteins were detected using anti-Myc antibodies (GenScript; A00704) and chemilumiscent ECL Plus substrate (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Bipartite proteins were detected using the rabbit anti-mCherry (A00682, GenScript, 1:3000 diluted), the mouse anti-His (A00186 ...
-
bioRxiv - Microbiology 2021Quote: ... All the proteins were endotoxin free (ToxinEraserTM Endotoxin Removal Kit, GenScript Biotechnology, Nanjing, China).
-
bioRxiv - Microbiology 2022Quote: ... 10^5 splenocytes were seeded and stimulated with peptides against S protein (From GenScript) (2μg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... gene segment containing spike protein of SARS-CoV-2 wa s synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2020Quote: Mouse mAb 10G6H5 against SARS-COV2 S protein was purchased from GenScript (Piscataway, NJ). Rabbit antisera against the S1 subunit ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... GiGrx5 and GiBolA proteins were detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal GiTom40 and GiIscU were detected with a specific polyclonal antibody raised in rabbits (84) ...
-
bioRxiv - Microbiology 2022Quote: ... fumigatus-optimized fluorescent protein mNeonGreen by using vector pSR25 (synthesized by GenScript, Piscataway, NJ). Primer pairs AtrR-CoNG MH F (CCCGGTCTTCGACACCA ATGGTCCACCCCACGGTGGATTGGCTGGTGCCGGTGCTGGT ...
-
bioRxiv - Biophysics 2022Quote: ... The fusion protein MBP-Q44-HttEx1 was subcloned into a pMalc2x plasmid by Genscript. The protein expression was done in Escherichia coli BL21(DE3 ...
-
bioRxiv - Microbiology 2023Quote: Full-length wMel WalE1 and wAna FtsZ protein-encoding constructs were synthesized by GenScript using codons optimized for E ...
-
bioRxiv - Cell Biology 2023Quote: ... DCP-Bio1-bound proteins were pulled down with Streptavidin-coated magnetic beads (Genscript #L00936) overnight at 4 °C following manufacturer’s protocol ...