Labshake search
Citations for GenScript :
401 - 450 of 847 citations for Mouse anti Plasmodium vivax CSP PVC 2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag-171Yb (clone HPC4, Genscript), anti-mCherry-142Nd (Abcam) ...
-
bioRxiv - Developmental Biology 2021Quote: Anti-ApoB-1 antibodies were generated by GenScript USA (Piscataway ...
-
bioRxiv - Immunology 2021Quote: ... anti-NWSHPQFEK (NWS) tag-159Tb (clone 5A9F9, Genscript), anti-AU1-162Dy (clone AU1 ...
-
bioRxiv - Plant Biology 2021Quote: ... goat polyclonal anti-HA (GenScript, cat. no. A00168), rabbit polyclonal anti-GFP (Abcam ...
-
bioRxiv - Plant Biology 2020Quote: ... Blots were probed with rabbit anti-FBN2 (GenScript, www.genscript.com at 1:5000 dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-human IgG peroxidase conjugated (A00166, GenScript, USA) or anti-mouse IgG peroxidase conjugated (A4416 ...
-
bioRxiv - Immunology 2022Quote: ... 6) TCRβ-CD3γ crosslinking: rabbit anti-V5 (Genscript) and mouse anti-VSV-G (Abcam) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... rabbit anti-p65me2 (customized antibody, Genscript, Piscataway, NJ), mouse anti-FLAG M2 (at 1:3,000 dilution ...
-
bioRxiv - Biophysics 2022Quote: ... Supernatant was load onto anti-FLAG resin (Genscript) by gravity flow ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... or rabbit anti-myc tag antibodies (GenScript; A00172).
-
bioRxiv - Cell Biology 2020Quote: ... or G1 Anti-DYKDDDDK affinity resin (GenScript, L00432) overnight at 4°C while rocking ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti α-Tubulin (Genscript, 1:50-1:100); Anti α-Tubulin (proteintech ...
-
bioRxiv - Cell Biology 2022Quote: ... rat-anti-Sasshort (1:50, GenScript USA Inc.); mAb Cq4 against crumbs (1:100 ...
-
bioRxiv - Genetics 2023Quote: ... and anti-HA rabbit monoclonal (GenScript; Catalog #A01963) were also used for co-IP and western immunoblotting reactions.
-
bioRxiv - Microbiology 2023Quote: ... or rabbit anti-protein C (1:3000, GenScript) as primary antibodies ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-Coq1 (custom made at Genscript, 1:2000), anti-Vdac1 (Abcam ab110326 ...
-
bioRxiv - Plant Biology 2023Quote: ... or a polyclonal anti-GFP antibody (GenScript, USA).
-
bioRxiv - Plant Biology 2023Quote: ... or a polyclonal anti-GFP antibody (GenScript, USA).
-
bioRxiv - Biochemistry 2023Quote: ... The anti-LHFPL5 construct was synthesized by Genscript. The DNA sequences encoding the heavy and light chains of the variable domains of the 39G7 and anti-LHFPL5 antibodies were cloned into the pEG BacMam vector for baculovirus expression in HEK293 tsa201 cells ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-tepsin 1:500 (in-house; Genscript) and 1:1000 (Robinson Lab ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-rat kangaroo-Kid (3μg/ml, Genscript). The anti-rat kangaroo Kid was raised against the full Kid protein translated from the coding sequence obtained from the PtK transcriptome (Udy et al. ...
-
bioRxiv - Plant Biology 2024Quote: ... Primary antibodies used included anti-myc (A00704, GenScript), anti-RFP (YH80520 ...
-
bioRxiv - Bioengineering 2022Quote: ... (GGGS)2 and mouse IL-10 (A3-IL-10) were synthetized and subcloned into the mammalian expression vector pcDNA3.1(+) by GenScript. To enable affinity-based purification ...
-
bioRxiv - Biophysics 2022Quote: The C-terminal FLAG-tagged mouse mGluR2 construct in pcDNA3.1(+) expression vector was purchased from GenScript (ORF clone: OMu19627D) and verified by sequencing (ACGT Inc) ...
-
bioRxiv - Biochemistry 2021Quote: ... and C: 861TLFRQM[pS]SGAI) with numbering indicating position in mouse HCN1 were commercially synthesized (GenScript Peptide Synthesis Service). Experiments were conducted at 25 °C in PBS (pH 7.4 ...
-
bioRxiv - Neuroscience 2021Quote: VH and VL sequences were identified in Biogen Idec’s patent submission for BIIB-037 WO2014089500 A1 and were cloned into mouse IgG2a and kappa pcDNA3.1 vectors (GenScript). Murine chimeric Aducanumab (Adu ...
-
bioRxiv - Molecular Biology 2022Quote: ... Full-length mouse IMPG1 variants were synthesized and inserted in a pcDNA3.1(+)-P2A-eGFP vector under a CMV promotor by Genscript. All IMPG1 proteins were expressed in HEK293 cells ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The RBD-ACE2 assay was performed using SARS-CoV-2 sVNT ready to use kit sold by Genscript Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a portion was taken for replating (2×10^4 cells per replicate) with human (GenScript Z03034-50) or mouse (GenScript Z02767-10 ...
-
bioRxiv - Biochemistry 2021Quote: Full length SARS-CoV-2 nsp3 was codon optimized and cloned into a pcDNA-(+)-C-DYK vector (Genscript). Truncations were performed using primers listed in Table 1 ...
-
bioRxiv - Immunology 2022Quote: ... A total of 500,000 splenocytes were restimulated ex vivo with the full-length SARS-CoV-2 B.1.1.529 S 15-mer (overlapping by 11 amino acids) peptide pool (GenScript) in plates pre-coated with anti-IFN-γ or anti-IL-4 antibodies ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR products were run in 2% agarose gel electrophoresis using a 100 bp DNA ladder (GenScript; CAT: M102O).
-
bioRxiv - Biochemistry 2020Quote: ... SARS-CoV-2 nsp7 gene (nucleotide 11846-12091, GenBank: MN908947.3) was synthesized de novo by GenScript (Nanjing, China) and cloned into the pMal-c5X vector using the same way as nsp8 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Genetics 2020Quote: ... fragment 2 was generated by amplification of the kh recoded rescue fragment from a plasmid synthesized by GenScript Inc. ...
-
bioRxiv - Immunology 2021Quote: 15-mer peptides that are overlapping by 10 amino acids (AA) spanning the entire SARS-CoV-2 Spike protein (GISAID EPI_ISL_410713) were synthesized (Genscript) and pooled into 7 pools of approximately 40 peptides in each pool (Supplementary Table 1) ...
-
bioRxiv - Immunology 2021Quote: ... a commercial competitive ELISA SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) was used (Genscript, New Jersey, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Neutralizing antibodies were routinely detected based on the SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) kit (GenScript). This ELISA-based kit detects antibodies that hinder the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Biophysics 2022Quote: The codon-optimized gene encoding the nsp7-10 region of SARS-CoV-2 polyprotein was synthesized commercially (GenScript) and cloned between the NdeI and XhoI sites of pET15b vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The clarified cell lysate was incubated with 2 ml pre-equilibrated Ni2+ charged magnetic resin purchased from GenScript. Briefly ...
-
bioRxiv - Plant Biology 2023Quote: ... dissolved in sterile H2O at 10mM) and BcNEP2 (Botrytis cinerea Necrosis and Ethylene-inducing protein 2; AIMYSWYMPKDEPSTGIGHRHDWE, Genscript www.genscript.com ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% penicillin-streptomycin) supplemented with 50 mM 2-mercaptoethanol and 1 μg/ml OVA257-264 (SIINFEKL) peptide (GenScript) at at 37 °C and 5% CO2 for 3 days ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Bioengineering 2020Quote: ... for detection of anti-L and anti-D antibodies plates were coated with either L-MMP peptide or D-MMP peptide resepcitvely (GenScript; sequence above) Serum samples were tested at a 1:500 dilution followed by incubation with alkaline phosphatase-labeled goat anti-mouse IgG1 or IgG2a ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with 50 nM human HER2:AF647 (Acro Biosystems) and 30 nM anti-VHH probe (MonoRab anti-Camelid VHH [iFluor 488], GenScript cat #A01862). The SARS-CoV-2 VHH strains were resuspended in saponin based stain buffer (1x PBS ...
-
bioRxiv - Cell Biology 2021Quote: The plasmid directing expression of mouse ARL16-myc in mammalian cells was obtained by first having the open reading frame synthesized by GenScript and later using PCR to amplify this open reading frame with insertion of the C-terminal myc epitope (EQKLISEEDL ...
-
bioRxiv - Microbiology 2019Quote: ... the dissected thrips tissues that were only incubated with secondary antibody (without adding primary antibody) and the tissues incubated with each pre-immune mouse antiserum (GenScript) were used as negative controls ...
-
bioRxiv - Cell Biology 2019Quote: IL-6 concentrations in the cell supernatant were were detected utilizing mouse IL -6 ELISA kit t (A015171517) purchased from GenScript Biological Technology Co.Ltd ...
-
bioRxiv - Biophysics 2021Quote: ... to produce antibodies, peptides corresponding to mouse C2CD6 (ALS2CR11) (359-377, EKLREKPRERLERMKEEYK) (Open Biosystems) and SLCO6C1 (1-14, MAHVRNKKSDDKKA) (GenScript) were synthesized and conjugated to KLH carrier protein ...