Labshake search
Citations for GenScript :
301 - 350 of 615 citations for Mouse Procollagen II C Terminal Propeptide PIICP CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Sepharose beads were then eluted with 0.5 mg/ml c-Myc peptide (Genscript) in TBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... blocked with 5% milk and probed with C-Myc antibody (Genscript A00173-100), Rad53 antibody (Abcam ab104232) ...
-
bioRxiv - Biochemistry 2021Quote: LD membrane protein cDNAs in pcDNA3.1+/C-(k)DYK were purchased from GenScript and their variants with the OPG2 tag ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... all with a C-terminus FLAG tag epitope (all from Genscript, Piscataway, NJ). Transfections were performed using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... The resulting products were cloned into pBluescript II KS (+) vector (Stratagene, La Jolla, CA, USA and GenScript Biotech, Netherlands). Linearized clones by HindIII or NotI were used as templates to generate antisense (HindIII ...
-
bioRxiv - Biophysics 2022Quote: ... Uniprot P13806-1), and rabbit CaVβ3 (477 residues, Uniprot P54286) followed by a Strep-tag II sequence68 were synthesized (GenScript) and each subcloned into a modified pFastBac expression vector having the polyhedrin promoter replaced by a mammalian cell active CMV promoter69 ...
-
bioRxiv - Molecular Biology 2023Quote: ... acidic coil motif (AQCEKELQALEKENAQLEWELQALEKELAQ) and Strep-Tag II (WSHPQFEK*) inserted into a pcDNA3.1-Hygro(-)-like backbone was synthesized commercially (GenScript). The R177G/R178G ...
-
bioRxiv - Bioengineering 2021Quote: ... pcDNA3.1+C-eGFP plasmid and plasmid encoding Cas9 and sgRNA were purchased from GenScript® ...
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Developmental Biology 2020Quote: ... Full-length mRNA constructs in pcDNA3.1+/C-(K)DYK vectors were obtained from GenScript Biotech (Piscataway ...
-
bioRxiv - Microbiology 2023Quote: Synthetic peptides of P covering the sequence N-EDDIYQLIM-C were obtained from GenScript. The peptide was dissolved in deionised water dosed with a drop of 5 M NH4OH to improve solubility ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Immunology 2022Quote: ... Horseradish peroxidase labeled mouse anti-His tag antibody (GenScript: A00186) was added for 30 minutes at 1:1000 dilution ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-mouse ZIP14 antibody was custom made by Genscript. Antibodies for GAPDH and actin were obtained from Cell Signalling.
-
bioRxiv - Microbiology 2022Quote: ... Mouse Anti-Rabbit IgG Fr secondary antibody (GenScript, Piscataway, NJ) 1:30,000 was used for assays of these rabbit-derived samples ...
-
Metal transporter SLC39A14/ZIP14 modulates regulation between the gut microbiome and host metabolismbioRxiv - Physiology 2021Quote: ... Rabbit anti-mouse ZIP14 antibody was custom made by Genscript. Antibodies for ZIP4 ...
-
bioRxiv - Immunology 2023Quote: ... with 200 μg of recombinant mouse IFN-γ alone (Genscript), 250 μg anti-CD115 (clone ASF98 ...
-
bioRxiv - Biophysics 2023Quote: ... followed by 10 nM biotinylated antibody (mouse anti-FLAG, GenScript). Chambers were flushed to remove reagents ...
-
bioRxiv - Plant Biology 2023Quote: ... and Goat- Anti-Mouse IgG [HRP] (1:3000; GenScript, A00160) secondary antibody ...
-
bioRxiv - Immunology 2023Quote: ... plus 10 ng/mL of mouse IL-2 (Z02764, Genscript) in 2 mL complete RPMI1640 medium for 72 h.
-
bioRxiv - Synthetic Biology 2021Quote: All gBlocks fragment containing 5 sgRNA expression cassettes with high fidelity four-base overhang pair2 after cutting with type IIS restriction enzyme BbsI restriction enzyme were designed and directly sent to be synthesized into PUC57 cloning plasmid by GenScript. Two oligos with BbsI cutting sites were annealed and cloned into backbone vector with CMV promoter drive fluorescent protein expression using SpeI-HF ...
-
bioRxiv - Biochemistry 2022Quote: ... a plasmid containing 400 bp upstream of the VPH1 open reading frame followed by the SPVD chimera and 400 bp corresponding to Vph1CT amino acids 406-539 cloned into pBluescript II KS(-) vector using BamHI and XhoI was purchased from Genscript. After restriction digestion with BamH1 and Xho1 ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Genetics 2023Quote: All assembly parts (consisting of fragments F1 to F12 designed in the previous protocol with appended Type IIS cut sites) were ordered as plasmids in a pUC57-mini BsaI-Free backbone from Genscript at a maxiprep scale (Supplementary Table 2) ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Biophysics 2020Quote: The GroES mobile loops3 ETKSAGGIVLTGS and GroEL C-tails (GGM)4M were ordered from Genscript. GroES mobile loops and C-tails were dissolved in MQ water and snap frozen using liquid nitrogen ...
-
bioRxiv - Immunology 2022Quote: ... was incubated with the substrate of ssDNA (ssBiotin 26nt Me-C Oligo 30 nM, Genscript), in the presence of aKG (115 μM ...
-
bioRxiv - Cell Biology 2022Quote: Tg-FLAG in pcDNA3.1+/C-(K)-DYK plasmid was purchased from Genscript (Clone ID OHu20241). The Tg-FLAG gene was then amplified and assembled with an empty pcDNA5/FRT expression vector using a HiFi DNA assembly kit (New England BioLabs ...
-
bioRxiv - Immunology 2022Quote: ... was incubated with the substrate of ssDNA (ssBiotin 26nt Me-C Oligo 30 nM, Genscript), in the presence of αKG (115 μM ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the pcDNA3.1+-C-(K)-DYK plasmid expressing Flag-EBP was purchased from GenScript (#OHu18817). Primers for site-directed mutagenesis of the EBP gene were designed using the QuikChange Primer Design Program (https://www.agilent.com/store/primerDesignProgram.jsp?_requestid=1072141 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Human C-type natriuretic peptide (CNP) and rat atrial natriuretic peptide (ANP) were from GenScript Corp ...
-
bioRxiv - Cancer Biology 2024Quote: ... and TTK genes were introduced in PANC-1 using pcDNA3.1+/C-(K)-DYK (GenEZ; GenScript) vectors (10 µg/ml) ...
-
bioRxiv - Plant Biology 2021Quote: ... followed by Goat Anti-Mouse IgG [HRP] (1:3000; GenScript A00160) as the secondary ...
-
bioRxiv - Immunology 2022Quote: ... 8) TCRβ-CD3εcrosslinking: mouse anti-V5 and rabbit anti-HA (Genscript); 9 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The mouse ASIC1a subunit was synthesized by GenScript (new Jersey, USA) with SacI and BamHI restriction sites flanking the start and stop codons ...
-
bioRxiv - Biochemistry 2020Quote: ... Blots were developed using HRP conjugated Goat anti-mouse IgG (Genscript) and luminata crescendo (Millipore) ...
-
bioRxiv - Biochemistry 2020Quote: ... Antibodies: Mouse pre-immune serum and antiserum after 3rd immunization (GenScript) was used 1:1000 ...
-
bioRxiv - Immunology 2022Quote: ... Mouse anti-His tag mAb conjugated with horseradish peroxidase (GenScript: A00186) at a 1:8000 dilution was added and incubated for 30 minutes at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... Human codon-optimized HSPH1 fused C-terminally to a Myc-tag was expressed from pcDNA3.1 (Genscript). cDNA encoding wild-type human ubiquitin containing an N-terminal HA-tag was expressed from pRK5-HA (Addgene) ...
-
bioRxiv - Cancer Biology 2021Quote: ... protein – NP_001058.2) cloned into pcDNA3.1+/C-(K)-DYK vector (Clone ID OHu21029D) was purchased from Genscript. The cDNAs were cloned into a bacterial expression vector ...
-
bioRxiv - Immunology 2020Quote: ... the complete open reading frame of murine HMGB1 was cloned into pcDNA3.1(+)-C-6His vector (GenScript). Transfection was performed using FectoPRO transfection reagent (Polyplus transfection) ...
-
bioRxiv - Immunology 2020Quote: ... at 95°C for 5 min and then separated using ExpressPlus PAGE Gels 4-20% (GenScript). Proteins were transferred to a polyvinylidene fluoride (PVDF ...
-
bioRxiv - Genetics 2023Quote: The expression vector for C-terminally Flag-tagged full-length human GDF15 was obtained from Genscript. The C211G mutant was generated by site-directed mutagenesis of the wild-type vector using the QuikChange II protocol (Agilent) ...
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... FAM177A1-Halo and FAM177A1-SNAP are all cloned fromFAM177A1 pcDNA3.1+/C-(K)-DYK (GenScript Clone ID:OHu30351D) using the primers in (Table S1 ...
-
bioRxiv - Plant Biology 2020Quote: ... and probed with HRP-conjugated mouse anti-rabbit (1:10,000, Genscript, #A01856) and horse anti-mouse (1:5000 ...
-
bioRxiv - Genetics 2019Quote: Rabbit polyclonal antibody for full-length mouse ZCWPW1 was made by GenScript. Rabbits were immunized with the full-length ZCWPW1 recombinant protein ...
-
bioRxiv - Biophysics 2019Quote: Human/mouse codon-optimized sequences encoding MerMAIDs were synthesized (GenScript, Piscataway, NJ) and cloned into the p-mCherry-C1 vector using NheI and AgeI restriction sites (FastDigest ...
-
bioRxiv - Neuroscience 2019Quote: ... which is 99% similar to the mouse version was synthesized by Genscript and cloned into the pAAV-hSyn-LMO3 plasmid to replace the hSyn promoter ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 ng/ml mouse recombinant Sonic Hedgehog (SHH)-C25II (Genscript, Z03050-50), and 10 μM CHIR99021 (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... The anti His-tag mouse antibody was from GenScript (cat no. A00186). Horseradish peroxidase-conjugated rabbit anti-mouse antibody was from Sigma-Aldrich ...