Labshake search
Citations for GenScript :
51 - 100 of 888 citations for Mouse N Myc Proto Oncogene Protein MYCN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: We chose gene fragments encoding complete deaminase domains as well as extra N and C protein sequences for commercial synthesis (GenScript) (fig ...
-
bioRxiv - Immunology 2023Quote: ... backbone and cDNA sequences for human NINJ1 (UniProtKB Q92982) or NINJ2 (UniProtKB Q9NZG7) protein with an N-terminal 3xFLAG tag and GSG linker were ordered from Genscript. For protein expression ...
-
bioRxiv - Biochemistry 2024Quote: ... gene was codon-optimized and cloned into the p423_GAL1 yeast expression vector as an N-terminal Flag (DYKDDDDK) and C-terminal deca-histidine (10X His) tagged fusion protein (GenScript) (Supplementary Fig ...
-
bioRxiv - Biochemistry 2020Quote: ... or into pcDNA3.1-(+)-N-DYK (nsp2) to append an N-terminal FLAG tag (GenScript).
-
bioRxiv - Cell Biology 2024Quote: Protein lysates were incubated with 1 µg mouse anti-V5 antibody (Genscript A01724) for 2 h at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... vector containing DENV2C protein gene sequence with N-terminal His tag and Tobacco Etch Virus (TEV) digestion site was purchased from GenScript (China). Recombinant capsid protein from DENV2 NGC strain was expressed in Escherichia coli BL21 strain ...
-
bioRxiv - Physiology 2022Quote: ... and 5KQ PDHA1-Myc were produced using custom gene synthesis (Genscript), and cloned into the pCMV-3Tag-4a plasmid vector ...
-
bioRxiv - Bioengineering 2023Quote: ... mAb was preferred for ELISA (GenScript, Cat.#A01854). For western blotting ...
-
bioRxiv - Biochemistry 2021Quote: ... The cDNAs were then cloned into pET-15b such that the expressed proteins would contain an N-terminal His-Tag (GenScript, Piscataway, NJ). Transformation of competent DH5α E ...
-
bioRxiv - Cell Biology 2022Quote: ... flanking the EVT region (intron is between the N and G residues) and the KLH-conjugated antibody was purified by protein G column (GenScript USA Inc.). Samples were mounted in VECTASHIELD (Vector Laboratories ...
-
bioRxiv - Microbiology 2020Quote: Mouse mAb 10G6H5 against SARS-COV2 S protein was purchased from GenScript (Piscataway, NJ). Rabbit antisera against the S1 subunit ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pCCL-WSB1 and pCCL-c-Myc plasmids were purchased from Genscript, and were re-constructed to pCDH vector with N-terminal FLAG tag ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nhel-IL2-scFv-Myc-EcoRV (produced by Genscript Biotech, New Jersey, USA), that contained hcY104A sequences preceded by the signal peptide from interleukin-2 (IL-2 ...
-
bioRxiv - Immunology 2023Quote: ... and N (GenScript, Cat No. A02090) were included at high (30µg/mL ...
-
bioRxiv - Microbiology 2022Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Synthetic Biology 2023Quote: ... SpyTag peptide (N-term-AHIVMVDAYKPTKGSGDRCG-C-term, N-term: Acetylation, C-term: Amidation, purity: 94%, GenScript Biotech) was dissolved in triethanolamine (TEA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sepharose beads were then eluted with 0.5 mg/ml c-Myc peptide (Genscript) in TBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... blocked with 5% milk and probed with C-Myc antibody (Genscript A00173-100), Rad53 antibody (Abcam ab104232) ...
-
bioRxiv - Cell Biology 2020Quote: pCDNA3.1-GFP-Rab10 and pCDNA3.1-Flag-Rab10 were generated by insertion of synthesized Rab10 cDNA into pCDNA3.1+N-EGFP plasmid or pCDNA3.1+/N-DYK plasmid from Genscript as described 13 ...
-
bioRxiv - Synthetic Biology 2023Quote: The expression levels of his-tagged nanobodies resulting from microfermentations were quantified using the His tag ELISA detection kit (GenScript, Cat# L00436) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... was purchased from GenScript (ref. n° OHu13506). The Myc-mKCNJ2-T2A-IRES-tdTomato.lti (#978 ...
-
bioRxiv - Cell Biology 2022Quote: Pulldown with N-terminally biotinylated peptides (GenScript) was carried out as follows ...
-
bioRxiv - Biochemistry 2023Quote: ... N and M were synthesized by GenScript to more than 98% purity except for the surrogate peptide for full-length GPC which could only be purified to 66% ...
-
bioRxiv - Plant Biology 2022Quote: ... His-FmASP protein was detected by immunoblotting with using a mouse anti-His antibody (GenScript, A00186). The immunoblotting band signals were visualized by enhanced enhanced chemiluminescence (ECL ...
-
bioRxiv - Biochemistry 2023Quote: The Fis1 N-terminal arm peptide (MEAVLNEL) with N-terminal acetylation and C-terminal amidation were purchased from GenScript who determined the peptide to be >95% pure by HPLC ...
-
bioRxiv - Cancer Biology 2024Quote: The pcDNA5/FRT/TO-Myc-FEN1 WT and E359K plasmids were synthesized by Genscript and include siResistance to FEN1 exon 2 siRNA GAUGCCUCUAUGAGCAUUUAU ...
-
bioRxiv - Immunology 2023Quote: ... The biotinylated SARS-CoV-2 fusion peptide (N’-biotin-DPSKPSKRSFIEDLLFNKVT-C’) and His-tagged HIV Env MPER peptide (N’-NWFDITNWLWYIKSGGSHHHHHHHH-C’) were chemically synthesized by GenScript.
-
bioRxiv - Molecular Biology 2019Quote: ... YBX1 was cloned into pcDNA3.1+N-EGFP (Genscript) and pmCherry-C1 (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... N-terminus biotinylated peptides were synthesized by Genscript. N-terminal GSGS linker sequence was added to all peptide sequences ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... expressing N-terminally FLAG-tag (GenScript, Leiden, Netherlands). A selection of truncated versions of the AhR and ARNT was done based on previously published data [27,30] ...
-
bioRxiv - Cancer Biology 2023Quote: ... PLXNB2 OHu01778C_pcDNA3.1(+) N-Terminal Flag-Tag (GenScript #SC1626), PLXNB2 OHu01778D_pcDNA3.1+/C- C-Terminal Flag-Tag (GeneScript #OHu01778D) ...
-
bioRxiv - Biochemistry 2023Quote: N-terminal biotinylated peptides were synthesized by Genscript at ≥95% purity and dissolved in 100% DMSO to a stock concentration of 10 µg/µL ...
-
bioRxiv - Biochemistry 2023Quote: ... or pcDNA-(+)-N-DYK vector for nsp2 (Genscript). An N-terminal truncation nsp3.1-FT (residues 1-749 ...
-
bioRxiv - Biochemistry 2021Quote: ... the fragments were inserted in frame after myc-tagged TRX1 in the pESC vector (Genscript). For production of DHFR and DHFR variants in E ...
-
bioRxiv - Cell Biology 2020Quote: ... pCDNA3.1-Myc-mKate2-EHBP1L1 is generated by insertion of synthesized mKate2 and EHBP1L1(OMu05300C, Genscript) into pcDNA3.1+N-MYC plasmid from Genscript.
-
bioRxiv - Molecular Biology 2020Quote: ... The following antibodies were used in this study: anti-myc (1:1000 Genscript A00173-100), anti-Rad53 (1:1000 Abcam ab104232) ...
-
bioRxiv - Immunology 2021Quote: ... preliminary ELISA screening and production of hybridomas were performed by Genscript as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... and tested for affinity with ELISA and Western blot by Genscript.
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 spikes or their N-to-Q or N-to-A substituted variants were codon optimized and cloned into pcDNA3.1(+) plasmid (GenScript, Piscataway, NJ). The HIV gag/pol (pCMVΔR8.2 ...
-
bioRxiv - Microbiology 2020Quote: Endotoxin of all purified proteins was removed with ToxinEraserTM Endotoxin Removal Kit (Genscript) in accordance to the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2020Quote: ... Human codon-optimized HSPH1 fused C-terminally to a Myc-tag was expressed from pcDNA3.1 (Genscript). cDNA encoding wild-type human ubiquitin containing an N-terminal HA-tag was expressed from pRK5-HA (Addgene) ...
-
CAP1 and cofilin1 cooperate in neuronal actin dynamics, growth cone function and neuron connectivitybioRxiv - Neuroscience 2020Quote: ... Following constructs were used: GFP-CAP1 and mutant GFP-CAP1 and deletion myc-CAP1 variants (GenScript), GFP (GenScript) ...
-
bioRxiv - Microbiology 2021Quote: ... the FLAG-tagged Vigilin cDNA was purchased from Genscript (Clone ID: OHu17734) and the Myc-tagged SERBP1 cDNA was purchased from Genscript (Clone ID: OHu26811C). After PCR ...
-
bioRxiv - Biochemistry 2020Quote: ... or N-terminal poly-histidine-tag (Genscript, codon-optimized) was expressed in E ...
-
bioRxiv - Microbiology 2023Quote: ... anti-CsoS2-N (1:10,000 dilution; synthesized by GenScript, NJ ...
-
bioRxiv - Biophysics 2023Quote: ... and N (GenBank: NC_045512.2) genes were synthesized by Genscript, Inc ...
-
bioRxiv - Microbiology 2021Quote: ... All the proteins were endotoxin free (ToxinEraserTM Endotoxin Removal Kit, GenScript Biotechnology, Nanjing, China).
-
bioRxiv - Cell Biology 2020Quote: ... Germany) and were cloned into pcDNA4/TO/myc/hisA for mammalian expression by GenScript (Piscataway, NJ, USA). The construction of the V5-tagged DNAJB plasmid library used in this study is described in Hageman and Kampinga (2009) ...
-
bioRxiv - Immunology 2022Quote: ... the following pairs of primary antibodies were used: 1) TCRα-TCRβ crosslinking: rabbit anti-c-Myc (Genscript) and mouse anti-V5 (Genscript) ...