Labshake search
Citations for GenScript :
151 - 200 of 742 citations for Mouse Eukaryotic Translation Termination Factor 1 ETF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: To generate pLenti-mTomm70A-EGFP the open reading frame of mouse Tomm70A (GenScript OMu13526) was amplified via PCR and inserted into pcDNA-EGFP introducing a ten amino acid long linker between mTomm70A and EGFP (GGSGDPPVAT) ...
-
bioRxiv - Cell Biology 2020Quote: ... To generate pLenti-mTimm50-mRFP the open reading frame of mouse Timm50 (GenScript OMu13400) was amplified via PCR and inserted into pcDNA-mRFP introducing a ten amino acid long linker between mTimm50 and mRFP (GGSGDPPVAT) ...
-
bioRxiv - Microbiology 2020Quote: Mouse mAb 10G6H5 against SARS-COV2 S protein was purchased from GenScript (Piscataway, NJ). Rabbit antisera against the S1 subunit ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse alpha-DG N terminal domain(a-DGN) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Immunology 2024Quote: ... and incubated with FITC conjugated anti-FLAG mouse monoclonal antibody (GenScript, Cat. No. A01632) at a concentration of 2 µg per million cells for 1 hr at 37 C in the dark ...
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Molecular Biology 2022Quote: ... Selected mouse IgG and IgK chains were cloned into humanized IgH and IgL vectors (Genscript).
-
bioRxiv - Biochemistry 2022Quote: ... for >5 min at room temperature and incubated with mouse anti-His antibody (Genscript A00186) at 0.1 µg/ml in EveryBlot buffer for 1 hr at room temperature or overnight at 4 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Dlx5 and Pbx1 coding sequences were amplified from mouse cDNA and cloned into pcDNA3.1 (Genscript). Meis2 vector was mutated with NEBuilder HiFi DNA Assembly kit (NEB ...
-
bioRxiv - Genetics 2021Quote: ... rat anti-RAD-51 (1:500, (20)), guinea pig anti-SUN-1 S24pi (1:700, (72)), chicken anti-GFP (1:500, (A01694, Genscript)) ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti α-Tubulin (Genscript, 1:50-1:100); Anti α-Tubulin (proteintech ...
-
bioRxiv - Cell Biology 2019Quote: ... Anti-EphB1 mouse monoclonal against EphB1 sequence (AA 528-541, DDDYKSELREQLPL) was custom made by GenScript. N-terminal biotin labeled cell permeable antennapedia peptide (AP ...
-
bioRxiv - Immunology 2019Quote: 96-well plates were coated overnight at 4°C with mouse anti-Avi-tag antibody (Genscript) at 2 μg/ml in PBS ...
-
bioRxiv - Immunology 2021Quote: ... A peptide representing the mouse ANGPTL4 amino acids 29-53 (29QPEPPRFASWDEMNLLAHGLLQLGH53) was also synthesized by Genscript) with the same C-terminal-GGGC modification ...
-
bioRxiv - Plant Biology 2022Quote: ... His-FmASP protein was detected by immunoblotting with using a mouse anti-His antibody (GenScript, A00186). The immunoblotting band signals were visualized by enhanced enhanced chemiluminescence (ECL ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse α-DG lacking the N-terminal domain (H30 – A316) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the muscle-specific MCK promoter ...
-
bioRxiv - Cancer Biology 2023Quote: The p53-5H7B9 mouse monoclonal antibody (subclass IgG2a) was purchased from GenScript (catalog number A01767-40) as lyophilized protein in PBS ...
-
bioRxiv - Genomics 2023Quote: ... with CloneEZ PCR Cloning Kit (GenScript #L00339). The pLenti-GIII-EF1α-CBX3-Flag-HA ...
-
LIR-dependent LMX1A/LMX1B autophagy crosstalk shapes human midbrain dopaminergic neuronal resiliencebioRxiv - Cell Biology 2019Quote: ... anti-FLAG (Genscript, A00187: IB, 1:1500; IF, 1:300); anti-GAPDH (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... anti-SpoVAD64 (1:10,000) and anti-His (1:4,000) (GenScript) antibodies ...
-
bioRxiv - Microbiology 2021Quote: ... Monoclonal anti-CodY antibody was generated by injection of CodY into the BALB/C mouse (Genscript, USA). Mouse anti-CodY IgG monoclonal antibody (IgG ...
-
bioRxiv - Neuroscience 2022Quote: ... codon optimized mouse Pcbp2 clone with N-terminal Flag epitope tag was produced by gene synthesis (Genscript) and cloned in pcDNA3.1 (Invitrogen).
-
bioRxiv - Neuroscience 2023Quote: ... the complete open reading frame of mouse NaV1.7 was cloned into the pcDNA3.1(+)-C-DYK vector (GenScript) with several modifications ...
-
LRP1 mediates leptin transport by coupling with the short-form leptin receptor in the choroid plexusbioRxiv - Neuroscience 2023Quote: ... Neuro-2a cells or HEK293 cells were transiently transfected with pcDNA3.1(+)-C-DYK-mLRP1 (mouse LRP1 CDS; NM_008512.2, Genscript) and pcDNA3.1(+)-N-HA-mLepR (mouse LepR isoform A CDS ...
-
bioRxiv - Developmental Biology 2020Quote: ... Dkk-1 (GenScript) was added to BM at final concentration of 100 ng/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... FAT-1 (Genscript), and FAT-2 (Genscript ...
-
bioRxiv - Microbiology 2022Quote: The ToxinSensor Chromogenic LAL Endotoxin Assay kit (GenScript) was used to determine endotoxin units/mL of culture ...
-
bioRxiv - Neuroscience 2024Quote: ... a toxin Eraser endotoxin removal kit (#L00338, Genscript) with a high efficiency endotoxin removal resin was employed ...
-
bioRxiv - Genomics 2021Quote: ... Ada2b (rabbit polyclonal, 1:1000; GenScript anti-amino-acid 1-330); anti-Flag-horseradish peroxidase (mouse ...
-
bioRxiv - Developmental Biology 2020Quote: The fraction of mouse Tbx4-lung mesenchyme specific enhancer (LME) (mm10, chr11:85,893,703-85,894,206, GenScript, ID U3154EL200-3)27 or Tbx4-LME containing putative Tcf/Lef sites mutated (GenScript ...
-
bioRxiv - Neuroscience 2022Quote: Mouse voltage-gated sodium channel 5934 base pair-long genes (mSCN8AWT, mSCN8AK1425TAG, and mSCN8AK1546TAG were synthetized by GenScript (mSCN8A ...
-
bioRxiv - Immunology 2022Quote: ... The cells were allowed to adhere for 24 hours prior to treatment with mouse IL11 (UniProtKB: P47873, GenScript) or mouse TGFβ1 (R&D Systems ...
-
bioRxiv - Bioengineering 2024Quote: ... iFluor 647-conjugated anti-His-tag antibody (pilot CYpHER detection and TfR human/mouse cross-reactivity, Genscript A01802); Alexa Fluor 647-conjugated anti-Fc Fab (Surface protein and CYpHER quantitation ...
-
bioRxiv - Neuroscience 2021Quote: ... plko.1-CMV.Puro-tGFP-shFoxg1 or plko.1-CMV.Puro-tGFP-shLuciferase (Genscript) plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... 1:100 (A00487, Genscript). All secondary antibodies were purchased from Invitrogen and used at 1:700 and were Alexa Fluor-488 Donkey anti-rabbit (A21206) ...
-
bioRxiv - Immunology 2022Quote: ... β-Actin (GenScript, 1:15,000), T-bet (clone 4B10 Santa Cruz ...
-
bioRxiv - Immunology 2022Quote: ... β-actin (GenScript, 1:15,000), goat anti-mouse (Jackson Immunoresearch ...
-
bioRxiv - Bioengineering 2022Quote: ... (GGGS)2 and mouse IL-10 (A3-IL-10) were synthetized and subcloned into the mammalian expression vector pcDNA3.1(+) by GenScript. To enable affinity-based purification ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were blocked with 5% milk in PBS+0.1%Tween-20 and probed with anti-EnvP sera or mouse anti-GAPDH antibody (Genscript), followed by goat anti-mouse HRP (Invitrogen ...
-
bioRxiv - Biophysics 2022Quote: The C-terminal FLAG-tagged mouse mGluR2 construct in pcDNA3.1(+) expression vector was purchased from GenScript (ORF clone: OMu19627D) and verified by sequencing (ACGT Inc) ...
-
bioRxiv - Biochemistry 2021Quote: ... and C: 861TLFRQM[pS]SGAI) with numbering indicating position in mouse HCN1 were commercially synthesized (GenScript Peptide Synthesis Service). Experiments were conducted at 25 °C in PBS (pH 7.4 ...
-
bioRxiv - Neuroscience 2021Quote: VH and VL sequences were identified in Biogen Idec’s patent submission for BIIB-037 WO2014089500 A1 and were cloned into mouse IgG2a and kappa pcDNA3.1 vectors (GenScript). Murine chimeric Aducanumab (Adu ...
-
bioRxiv - Molecular Biology 2022Quote: ... Full-length mouse IMPG1 variants were synthesized and inserted in a pcDNA3.1(+)-P2A-eGFP vector under a CMV promotor by Genscript. All IMPG1 proteins were expressed in HEK293 cells ...
-
bioRxiv - Molecular Biology 2022Quote: Custom mouse monoclonal (clone 30E2-2) was raised against acetylated K164-SAE2 peptide (HP{Lys-Ac}PTQRTFPGC) by GenScript. Available on request to the corresponding author subject to completion of an M.T.A.
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times with goat anti-rabbit IgG antibody or goat anti-mouse IgG antibody (GenScript) for one hour followed by washing three times with TBST again ...
-
bioRxiv - Neuroscience 2023Quote: ... using the High-Affinity Antibody Purification Kit (L00404, GenScript) following the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2020Quote: ... 1-932 and EAV nsp9 1-693 was synthesized with codon optimization (Genscript) and cloned into pFastBac with an N-terminal MG addition and C-terminal TEV protease site and two Strep tags ...
-
bioRxiv - Cell Biology 2021Quote: The plasmid directing expression of mouse ARL16-myc in mammalian cells was obtained by first having the open reading frame synthesized by GenScript and later using PCR to amplify this open reading frame with insertion of the C-terminal myc epitope (EQKLISEEDL ...