Labshake search
Citations for GenScript :
151 - 200 of 571 citations for Mouse Ecto NOX Disulfide Thiol Exchanger 2 ENOX2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and 0.6 μg/mL SARS-CoV-2 S-ECD (GenScript). After washes with PBST (SMART-Lifesciences) ...
-
bioRxiv - Physiology 2022Quote: ... The WT dynamin-2 mCherry plasmid were constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Plant Biology 2021Quote: ... followed by Goat Anti-Mouse IgG [HRP] (1:3000; GenScript A00160) as the secondary ...
-
bioRxiv - Immunology 2022Quote: ... 8) TCRβ-CD3εcrosslinking: mouse anti-V5 and rabbit anti-HA (Genscript); 9 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The mouse ASIC1a subunit was synthesized by GenScript (new Jersey, USA) with SacI and BamHI restriction sites flanking the start and stop codons ...
-
bioRxiv - Biochemistry 2020Quote: ... Blots were developed using HRP conjugated Goat anti-mouse IgG (Genscript) and luminata crescendo (Millipore) ...
-
bioRxiv - Biochemistry 2020Quote: ... Antibodies: Mouse pre-immune serum and antiserum after 3rd immunization (GenScript) was used 1:1000 ...
-
bioRxiv - Immunology 2022Quote: ... Mouse anti-His tag mAb conjugated with horseradish peroxidase (GenScript: A00186) at a 1:8000 dilution was added and incubated for 30 minutes at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Plant Biology 2020Quote: ... and probed with HRP-conjugated mouse anti-rabbit (1:10,000, Genscript, #A01856) and horse anti-mouse (1:5000 ...
-
bioRxiv - Genetics 2019Quote: Rabbit polyclonal antibody for full-length mouse ZCWPW1 was made by GenScript. Rabbits were immunized with the full-length ZCWPW1 recombinant protein ...
-
bioRxiv - Biophysics 2019Quote: Human/mouse codon-optimized sequences encoding MerMAIDs were synthesized (GenScript, Piscataway, NJ) and cloned into the p-mCherry-C1 vector using NheI and AgeI restriction sites (FastDigest ...
-
bioRxiv - Neuroscience 2019Quote: ... which is 99% similar to the mouse version was synthesized by Genscript and cloned into the pAAV-hSyn-LMO3 plasmid to replace the hSyn promoter ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 ng/ml mouse recombinant Sonic Hedgehog (SHH)-C25II (Genscript, Z03050-50), and 10 μM CHIR99021 (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... The anti His-tag mouse antibody was from GenScript (cat no. A00186). Horseradish peroxidase-conjugated rabbit anti-mouse antibody was from Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... 4) TCRβ-CD3δ crosslinking: mouse anti-V5 and rabbit anti-FLAG (Genscript); 5 ...
-
bioRxiv - Immunology 2022Quote: ... 7) TCRβ-CD3ε crosslinking: rabbit anti-V5 and mouse anti-HA (Genscript); 8 ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by secondary Goat Anti-Mouse IgG [HRP] (1:3000; A00160, Genscript). Proteins were detected with SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... the plasmid construct with the mouse Ch25h gene in pcDNA3.1 (Genscript, OMu18523D) was used to define the standard curve ...
-
bioRxiv - Biochemistry 2021Quote: ... a mouse monoclonal DKY-Tag antibody diluted 1:1,000 (GenScript, Cat# A00187) and a mouse monoclonal anti-β-Actin antibody diluted 1:1,500 (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: The following commercial antibodies were used: FLAG (A00187, GenScript, mouse, 1:1000); HA (11867423001 ...
-
LRP1 mediates leptin transport by coupling with the short-form leptin receptor in the choroid plexusbioRxiv - Neuroscience 2023Quote: ... and pcDNA3.1(+)-N-HA-mLepR (mouse LepR isoform A CDS; NM_001122899.2, Genscript) using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... THE™ His Tag mouse antibody (GenScript, Nanjin, China; diluted 1: 2000) was used as the primary antibody ...
-
bioRxiv - Microbiology 2021Quote: ... polyclonal anti-Bma-LAD-2 peptide antibodies were generated by Genscript. Rabbits were immunized with Bma-LAD-2 peptide sequences conjugated to keyhole limpet hemocyanin (KLH) ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding SARS-CoV-2 and other coronavirus S-2P (Genscript) were transiently transfected in FreeStyle 293-F cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Codon-optimized spike of SARS-CoV-2 was purchased from GenScript and subcloned to pcDNA3.1 ...
-
bioRxiv - Immunology 2021Quote: ... SARS CoV-2 Nucleocapsid human chimeric mAb (GenScript, Cat # A02039-100), or in-house antibodies to ORF3a and ORF8 served as positive controls ...
-
bioRxiv - Microbiology 2022Quote: ... An anti-SARS-2 nucleocapsid protein rabbit antiserum (generated by GenScript) was used at a 1:1000 dilution to detect specific anti–SARS-2 immunoreactivity using the Discovery ULTRA automated staining instrument (Roche Tissue Diagnostics ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein-crud (RP30020, GenScript Biotecn Corp). A ten amino acid overlapping peptide mixture pool was prepared ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 spike gene (Wuhan) was synthesized by Genscript for Dr ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 N and S1 proteins were obtained from Genscript and Sino Biological.
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 2 mL of nickel resin (GenScript) at RT for 20 minutes and washed once with lysis buffer and another three times with wash buffer (20 mM Tris-Cl pH8.8 ...
-
bioRxiv - Cell Biology 2021Quote: ... and a mouse monoclonal antibody to detect GAPDH (clone 3B1E9, GenScript A01622–40) were used at a dilution of 1:1,000 in blocking buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP) labeled-mouse anti-human IgG-Fc specific (GenScript No. A01854) diluted 1:10,000 in PBST was added (100μl/well ...
-
bioRxiv - Microbiology 2021Quote: ... Mouse anti-CodY IgG monoclonal antibody (IgG) was generated and purified (Genscript, USA).
-
bioRxiv - Microbiology 2022Quote: ... The primary antibody for Western blot is Mouse-anti-His mAb (GenScript, Cat.No.A00186). The concentration was determined by BCA protein assay with BSA as a standard ...
-
bioRxiv - Physiology 2021Quote: The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Immunology 2022Quote: ... then 3.5μL of 1 mg/ml normal mouse IgG (mIgG) (GenScript, Cat# A01007) was added ...
-
bioRxiv - Biochemistry 2022Quote: The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the muscle-specific MCK promoter (gift from Jeff Chamberlain) ...
-
bioRxiv - Genomics 2023Quote: CUT&Tag was performed with mouse anti-HA antibodies (1:100, Genscript #A01244), rabbit anti-H3K4me3 antibodies (1:100 ...
-
bioRxiv - Biophysics 2023Quote: ... human/mouse codon-optimized genes coding for the identified ChRs were ordered (GenScript, Piscataway ...
-
bioRxiv - Cell Biology 2024Quote: Protein lysates were incubated with 1 µg mouse anti-V5 antibody (Genscript A01724) for 2 h at 4°C ...
-
bioRxiv - Genetics 2024Quote: ... HRP-conjugated mouse monoclonal antibody against FLAG was obtained from GenScript (Cat# A01428).
-
bioRxiv - Biochemistry 2023Quote: Sequences encoding mouse WT and site-mutated DAG1 were synthesized (GenScript, Piscataway, NJ) and cloned into adeno-associated virus 2/9 (AAV2/9 ...