Labshake search
Citations for GenScript :
1 - 50 of 987 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... or the truncated version of Npnt containing only the N-terminal EGF-like repeats domain (Npnt-EGF) were commercially synthesized (Genscript) and cloned into the modified RCAS vector ...
-
bioRxiv - Biophysics 2021Quote: ... Purified EGF-like domain of NRG1β was incubated with G1 Flag Resin (Genscript) for 1 hr at 4 °C and serially washed 3x with Buffer A (50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Biochemistry 2024Quote: ... Purified EGF-like domain of NRG1ý or BTC was incubated with anti-DYKDDDDK G1 affinity resin (Genscript, short anti-Flag) for 1 hour at 4 °C and serially washed 3x with Buffer A (50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Biochemistry 2021Quote: ... SMT (SUMO-like tag) fusion protein in a pET28a vector (Genscript). Quick Change mutagenesis was performed to generate the W611A mutant of hP13 ZnF5-WWE1-WWE2 ...
-
bioRxiv - Physiology 2021Quote: The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Biochemistry 2022Quote: The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the muscle-specific MCK promoter (gift from Jeff Chamberlain) ...
-
bioRxiv - Microbiology 2022Quote: ... The N-terminal domain (Delta-like) of the SARS-CoV-2 Delta-Omicron recombinant spike was chemically synthesized as a short fragment (Genscript) and fused by overlapping PCR with the RBD and C-terminal parts of the BA.1 spike ...
-
bioRxiv - Biochemistry 2020Quote: ... ZmGl2-like sequence was initially obtained from GenScript as a pUC57-clone and was sub-cloned into pENTRTM/D-TOPO® entry vector (Invitrogen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Arylphorin subunit alpha-like (Demetra) and hexamerin (Ceres) were produced by Genscript, utilizing the baculovirus expression system in insect cells ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the mutated uricase-like coding sequence was synthesized by Genscript (USA Inc.) into a pET28 expression vector ...
-
bioRxiv - Biophysics 2024Quote: 5X repeat Nck SH3 domain 2 (polySH3) and 5X repeat Abl PRM (polyPRM) codon-optimized genes were purchased from GenScript and cloned into a pMal plasmid to generate fusion proteins with an N-terminal Maltose Binding Protein (MBP ...
-
bioRxiv - Biophysics 2022Quote: The peptide library spanning the tau repeat domain residues was synthesized from GenScript, ensuring each peptide was of sufficient purity (>90% ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the uricase-like coding sequence (XM_015290876.2) of LOC101747367 was synthesized by Genscript (USA Inc.) into pcDNA3.1+/ C-(K)DYK standard vector ...
-
bioRxiv - Microbiology 2020Quote: ... class C-like β-lactamase protein (gi|919167542) and the Elizabethkingia GOB-13 (AY647250) were synthesized by GenScript (Piscataway, NJ, USA) and optimized for protein expression in Escherichia coli in the pET24a(+ ...
-
bioRxiv - Molecular Biology 2023Quote: ... basic coil motif (AQCKKKLQALKKKNAQLKWKLQALKKKLAQ) and 6xHIS tag inserted into a pcDNA3.1-Hygro(-)-like backbone was synthesized commercially (GenScript). The region encoding the α4 ectodomain (M1-Q970 ...
-
bioRxiv - Molecular Biology 2023Quote: ... acidic coil motif (AQCEKELQALEKENAQLEWELQALEKELAQ) and Strep-Tag II (WSHPQFEK*) inserted into a pcDNA3.1-Hygro(-)-like backbone was synthesized commercially (GenScript). The R177G/R178G ...
-
bioRxiv - Biochemistry 2020Quote: The selected LDKA-like peptides were synthesized using standard Fmoc chemistry and purified to 98% purity using reverse phase HPLC by GenScript, Inc (Piscataway ...
-
bioRxiv - Immunology 2021Quote: RBD and NP end-point titers were determined using standard ELISA and plates coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) or 1ug/mL SARS-CoV-2 nucleocapsid protein (NP) ...
-
bioRxiv - Immunology 2021Quote: RBD end-point titers were determined using standard ELISA and plates were coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) Heat inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Biophysics 2020Quote: ... SARS CoV-2 papain-like protease (PLpro) gene (ORF 1ab 1564 to 1876) from strain BetaCoV/Wuhan/WIV04/2019 was ordered from GenScript (Piscataway, NJ) in the pET28b(+ ...
-
bioRxiv - Molecular Biology 2023Quote: ... Equal amounts of GST-G12-like and His-AaCPR100A sonicated lysates were mixed with high-affinity GST resin (GenScript, Piscataway, NJ, USA), and then eluted ...
-
bioRxiv - Biochemistry 2020Quote: ... and Gl2-like (GRMZM2G315767; Zm00001d024317) ORFs were codon-optimized for expression in Arabidopsis with GeneOptimizer (GeneArt, LifeTechnologies) and OptimumGeneTM (GenScript, Piscataway, NJ; www.genscript.com), respectively ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding N-terminal domain proteins were obtained from GenScript. Plasmids were transiently co-transfected in FreeStyle 293-F cells using 293Fectin (ThermoFisher) ...
-
bioRxiv - Biochemistry 2023Quote: ... thirteen 601 repeats were synthesized (GenScript) in which naturally occurring AvaI and AluI sites in the canonical 601 sequenced were replaced with unique restriction sites ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 24 PP7 repeats were synthesized (GenScript) along with Hba-a1 coding sequences between two KflI sites at the 5’ end of the gene and subsequently exchanged by standard restriction enzyme digestion and re-ligation with sequence in the above p15 plasmid to obtain the final p15A-loxP-Hba-a1-PP7-lox511 construct to be used as the RMCE donor vector.
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV-2 Spike protein (S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ) was added at concentrations ranging from 0.07 to 500 to nM ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse alpha-DG N terminal domain(a-DGN) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... Chimeric Plexin-B constructs containing Plexin-B1 and Plexin-B2 domain swaps were produced by Genscript. Target sequences for the ECD ...
-
bioRxiv - Neuroscience 2022Quote: ... we obtained an expression plasmid containing a C-terminal 3Xflag tagged BioID2 sequence with a 198bp (13X “GGGGS” repeat) linker sequence upstream of BioID2 (Genscript). For lentiviral expression ...
-
bioRxiv - Neuroscience 2022Quote: ... we obtained an expression construct containing a 198bp (13x “GGGGS” repeat) linker sequence upstream of a C-terminal 3xFLAG-tagged BioID2 sequence with BioID2 (Genscript). For lentiviral expression ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmids containing the N171 N-terminal fragment sequence of human HTT bearing either 85 CAG repeats (HTT85Q, pathological HTT fragment) or 10 CAG repeats (HTT10Q, control HTT fragment) were manufactured by GenScript and subsequently cloned into a transgene cassette flanked by viral inverted terminal repeats (ITRs) ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV2 Spike protein (100 nM, S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ), EG00229 (Cat#6986 ...
-
bioRxiv - Immunology 2023Quote: ... the commercialized ELISA kit (Genscript, Cat#L00871) was used ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse α-DG lacking the N-terminal domain (H30 – A316) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the muscle-specific MCK promoter ...
-
bioRxiv - Biophysics 2022Quote: The C terminal domain of Influenza A Matrix protein 1 (M1C) was subcloned into pET15b vector (GenScript). In addition to the M1C sequence ...
-
bioRxiv - Cell Biology 2019Quote: IL-6 concentrations in the cell supernatant were were detected utilizing mouse IL -6 ELISA kit t (A015171517) purchased from GenScript Biological Technology Co.Ltd ...
-
bioRxiv - Plant Biology 2020Quote: ... three separated segments (excluding the TCP domain) from the COM1 gene each containing 300-360 bp were synthesized (probe 1 and 2, GenScript Biotech ...
-
bioRxiv - Microbiology 2020Quote: ... 21 crRNA-encoding spacers separated by repeats were synthesized by GenScript and provided on a pUC57 vector (pMME1170) ...
-
bioRxiv - Biophysics 2024Quote: ... a plasmid encoding 26X repeats of the miR-34a transcript (Genscript) was transcribed via T7 RNA polymerase (T7 RNAP ...
-
bioRxiv - Cell Biology 2024Quote: ... T4E in every other repeat) were ordered as synthetic genes (Genscript), amplified ...
-
bioRxiv - Biophysics 2022Quote: Fusion peptide domains (FP1, FP2 and FP1-FP2) of the SARS-CoV-2 spike protein were synthesized by GenScript with a purity ≥ 95% ...
-
bioRxiv - Genetics 2023Quote: ... A plasmid containing mouse Pax1 (GenScript; OMu21524) was used as template for DIG-labeled probes ...
-
bioRxiv - Molecular Biology 2023Quote: We chose gene fragments encoding complete deaminase domains as well as extra N and C protein sequences for commercial synthesis (GenScript) (fig ...
-
bioRxiv - Microbiology 2021Quote: Mutant csp repeat region oligonucleotides were commercially synthesized by Genscript (Piscataway, NJ) and provided in the pUC57 plasmid ...
-
bioRxiv - Biochemistry 2022Quote: ... of the human CRX protein was fused to a 6x His-tag inserted following the met start codon and subcloned into the commercial PMAL-c5x expression plasmid containing a maltose binding domain (MBD) coding sequence using Xmnl and EcoR1 restriction sites (GenScript, Piscataway, NJ). CRX DBD-MBD plasmid was transformed into BL21 E ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein of the extracellular domain of human ACE2 (aa 1-740) fused to Fc (ACE2-Fc, Genscript, Nanjing, China) was coated on 96-well microtiter plate (50 ng/well ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...