Labshake search
Citations for GenScript :
501 - 550 of 1086 citations for Mouse DTW Domain Containing Protein 2 DTWD2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... followed by secondary Goat Anti-Mouse IgG [HRP] (1:3000; A00160, Genscript). Proteins were detected with SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... the plasmid construct with the mouse Ch25h gene in pcDNA3.1 (Genscript, OMu18523D) was used to define the standard curve ...
-
bioRxiv - Biochemistry 2021Quote: ... a mouse monoclonal DKY-Tag antibody diluted 1:1,000 (GenScript, Cat# A00187) and a mouse monoclonal anti-β-Actin antibody diluted 1:1,500 (Sigma Aldrich ...
-
LRP1 mediates leptin transport by coupling with the short-form leptin receptor in the choroid plexusbioRxiv - Neuroscience 2023Quote: ... and pcDNA3.1(+)-N-HA-mLepR (mouse LepR isoform A CDS; NM_001122899.2, Genscript) using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: The following commercial antibodies were used: FLAG (A00187, GenScript, mouse, 1:1000); HA (11867423001 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... THE™ His Tag mouse antibody (GenScript, Nanjin, China; diluted 1: 2000) was used as the primary antibody ...
-
bioRxiv - Microbiology 2021Quote: ... polyclonal anti-Bma-LAD-2 peptide antibodies were generated by Genscript. Rabbits were immunized with Bma-LAD-2 peptide sequences conjugated to keyhole limpet hemocyanin (KLH) ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding SARS-CoV-2 and other coronavirus S-2P (Genscript) were transiently transfected in FreeStyle 293-F cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Codon-optimized spike of SARS-CoV-2 was purchased from GenScript and subcloned to pcDNA3.1 ...
-
bioRxiv - Immunology 2021Quote: ... SARS CoV-2 Nucleocapsid human chimeric mAb (GenScript, Cat # A02039-100), or in-house antibodies to ORF3a and ORF8 served as positive controls ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein-crud (RP30020, GenScript Biotecn Corp). A ten amino acid overlapping peptide mixture pool was prepared ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 spike gene (Wuhan) was synthesized by Genscript for Dr ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 2 mL of nickel resin (GenScript) at RT for 20 minutes and washed once with lysis buffer and another three times with wash buffer (20 mM Tris-Cl pH8.8 ...
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Biochemistry 2022Quote: The intein-7-140 α-syn fusion protein cDNA was synthesized by GenScript and inserted into a pT7-7 plasmid ...
-
bioRxiv - Plant Biology 2021Quote: ... using a highly efficient wet protein transfer system (eBlot L1; GenScript, Nanjing, China). The membranes were blocked for 2 h at room temperature in TBST solution (2 mM This-HCl ...
-
bioRxiv - Biochemistry 2021Quote: LD membrane protein cDNAs in pcDNA3.1+/C-(k)DYK were purchased from GenScript and their variants with the OPG2 tag ...
-
bioRxiv - Immunology 2022Quote: ... and the supernatants were further purified with protein A magnetic beads (Genscript, L00695).
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was collected pre-cleared with 20 µl Protein A/G MagBeads (GenScript) per 1.5 ml lysate for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: Protein samples were separated in a pre-cast SDS-PAGE gel (GenScript, M00657) and blotted to a PVDF membrane (EMD Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids expressing human KLF family proteins were purchased from Genscript (Piscataway, NJ) or OriGene (Rockville ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins with a His tag was purified with the Ni-NTA resin (Genscript) according to the product manual ...
-
bioRxiv - Molecular Biology 2023Quote: ... The bound proteins were eluted with Flag peptide (200 μg/ml; GenScript, RP10586) in thermomixer at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... This clarified protein lysate was then shaken with Ni-charged IMAC Magbeads (Genscript) for 1 hour to bind tagged proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant BRD4 N-terminal protein was purchased from GenScript (BRD4-N (49-460aa), His ...
-
bioRxiv - Neuroscience 2024Quote: ... 8 µg of protein was loaded onto a 10% SurePAGE polyacrylamide gel (Genscript) and resolved for 1 cm ...
-
bioRxiv - Immunology 2021Quote: ... Antibody VH or VL sequences were cloned into plasmids containing an IgG1 or relevant light chain backbone (Genscript) and used to transfect Expi293 cells (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... the supernatant was transferred into a 1.5ml microfuge tube containing the pre-washed Ni-NTA magnetic beads (GenScript) and incubated on a shaker at room temperature for 1 hour ...
-
bioRxiv - Immunology 2023Quote: Antibody heavy chain and light chain genes were synthesized and cloned into plasmids containing the CMV promoter (GenScript). Final heavy and light chain plasmids were amplified ...
-
bioRxiv - Immunology 2023Quote: ... Antibody VH or VL sequences were cloned into plasmids containing an IgG1 or relevant light chain backbone (GenScript) and transfected into Expi293 cells (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2024Quote: ... the Schneider’s medium was replaced by Schneider’s medium containing 100 ng/mL of different synthesized Drosophila neuropeptides (Genscript, the sequences of the peptides are shown in Supplementary Table 2) ...
-
bioRxiv - Cell Biology 2021Quote: ... and a mouse monoclonal antibody to detect GAPDH (clone 3B1E9, GenScript A01622–40) were used at a dilution of 1:1,000 in blocking buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP) labeled-mouse anti-human IgG-Fc specific (GenScript No. A01854) diluted 1:10,000 in PBST was added (100μl/well ...
-
bioRxiv - Microbiology 2021Quote: ... Mouse anti-CodY IgG monoclonal antibody (IgG) was generated and purified (Genscript, USA).
-
bioRxiv - Microbiology 2022Quote: ... The primary antibody for Western blot is Mouse-anti-His mAb (GenScript, Cat.No.A00186). The concentration was determined by BCA protein assay with BSA as a standard ...
-
bioRxiv - Physiology 2021Quote: The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Immunology 2022Quote: ... then 3.5μL of 1 mg/ml normal mouse IgG (mIgG) (GenScript, Cat# A01007) was added ...
-
bioRxiv - Biochemistry 2022Quote: The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the muscle-specific MCK promoter (gift from Jeff Chamberlain) ...
-
bioRxiv - Biophysics 2023Quote: ... human/mouse codon-optimized genes coding for the identified ChRs were ordered (GenScript, Piscataway ...
-
bioRxiv - Genomics 2023Quote: CUT&Tag was performed with mouse anti-HA antibodies (1:100, Genscript #A01244), rabbit anti-H3K4me3 antibodies (1:100 ...
-
bioRxiv - Biochemistry 2023Quote: Sequences encoding mouse WT and site-mutated DAG1 were synthesized (GenScript, Piscataway, NJ) and cloned into adeno-associated virus 2/9 (AAV2/9 ...
-
bioRxiv - Genetics 2024Quote: ... HRP-conjugated mouse monoclonal antibody against FLAG was obtained from GenScript (Cat# A01428).
-
bioRxiv - Cell Biology 2020Quote: ... Antagonist peptide 1 (SCSLFTCQNGIV) and 2 (SCSLFTCQNGGGWF) were chemically synthesized by Genscript. Anti-Mouse-IgG (H&L ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant SARS-CoV-2-RBD (T80302) was obtained from Genscript (NanJing, China). Antagonist peptide 1 (SCSLFTCQNGIV ...
-
bioRxiv - Systems Biology 2019Quote: ... half of the cells were stimulated with erythropoietin (2 ng/mL; GenScript) 24 hours after transfection ...