Labshake search
Citations for GenScript :
101 - 150 of 587 citations for Mouse DPH7 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... The lentiCRISPRv2-sgEPHA2-1 plasmid was purchased from Genscript. NT sgRNA sequences were taken from the GeCKO (version 2 ...
-
bioRxiv - Immunology 2021Quote: The CD73-FCyRIII_pcDNA3.1(+) plasmid was custom-cloned by Genscript using the mammalian expression vector pcDNA3.1(+ ...
-
bioRxiv - Immunology 2021Quote: ... using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Immunology 2021Quote: ... using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Cell Biology 2022Quote: ... The pcDNA3.1-eGFP-S plasmid was purchased from Genscript. We reconstructed pcDNA3.1 plasmids coding membrane ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid vectors were purchased from GenScript (clone BAFF, OHu22261). Nucleofection (Nucleofector kit V ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid pAAV-CamKII-Nptx2-V5 was generated by GenScript, by cloning a synthesized CamKII-Nptx2-V5-miR204 DNA fragment upstream of the WPRE-hGHpA sequence of a plasmid derived from plasmid CAG-NLS-GFP (a gift from Viviana Gradinaru ...
-
bioRxiv - Immunology 2022Quote: ... synthesized and cloned into an mRNA production plasmid (GenScript) as described[46] ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and supplied on a pGEX-4T plasmid by Genscript. The primers F-gst-xr and R-gst-xr (Table S4 ...
-
bioRxiv - Cancer Biology 2022Quote: The following epitope tagged plasmids were obtained from GenScript using the Express Cloning service ...
-
bioRxiv - Microbiology 2023Quote: ... Novel plasmids were synthesized by Genscript (Piscataway, NJ, USA). We built a FVV expressing β-galactosidase with a nuclear localization signal (puc2MD9-B-GAL ...
-
bioRxiv - Microbiology 2023Quote: Plasmid pBLS820 was custom produced by GenScript (Piscataway, NJ) by cloning the B ...
-
bioRxiv - Biochemistry 2023Quote: ... The plasmid of tetraubiquitin (Ub4) was ordered from GenScript. This plasmid contains the ubiquitin gene repeated four times and contains a N-term GST tag as well as a 3C HRV cleavage site.
-
bioRxiv - Biochemistry 2023Quote: All pcDNA3.1 plasmids constructed here were produced by GenScript.
-
bioRxiv - Bioengineering 2023Quote: ... from a plasmid purchased from Genscript (Genscript Biotech Corporation) using the following primer set ...
-
bioRxiv - Genomics 2023Quote: ... plasmids containing wild type ORFs were obtained from GenScript. The ORFs were cloned into the pcDNA3.1(- ...
-
bioRxiv - Molecular Biology 2024Quote: ... and all plasmids were manufactured by Genscript (Piscataway, NJ). Plasmid DNAs were expanded and isolated using a Qiagen Maxiprep kit (Cat 12162 ...
-
bioRxiv - Neuroscience 2024Quote: ... and all plasmids were manufactured by Genscript (Piscataway, NJ). Plasmid DNA was expanded and isolated using a QIAGEN Plasmid Maxi Kit (Germantown ...
-
bioRxiv - Microbiology 2024Quote: ... and BA.2.87.1 plasmids were all synthesized by GenScript Biotech (Piscataway ...
-
bioRxiv - Cell Biology 2024Quote: ... and plasmid sequencing was performed by Genscript (Piscataway, NJ), unless otherwise indicated.
-
bioRxiv - Immunology 2022Quote: ... and mouse anti-V5 (Genscript); 2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or mouse (GenScript Z02767-10) IL-6 or w/o.
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-GST (GenScript ; #A00865) and mouse anti-V5 (Life Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse cytochrome b561 (NM_007805.4, Genscript) and pcDNA3-SypHluorin2 (#37005 ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse IL11 (mIL11, Z03052, Genscript).
-
bioRxiv - Developmental Biology 2022Quote: ... amplified and inserted into the pcDNA3.1 plasmid (GenScript, Nanjing, China) with HA/Flag sequences in-frame fused to produce recombinant plasmids Cep78-HA ...
-
bioRxiv - Microbiology 2021Quote: ... plasmids (pNW2301 and pNW2305 respectively) were synthetically produced by Genscript ™ ...
-
bioRxiv - Microbiology 2022Quote: ... plasmid with codon-optimized synthetic DNA sequences (GenScript, Piscataway, NJ) coding for a portion of 1ab polyproteins of SARS-CoV-2 (NCBI ...
-
bioRxiv - Developmental Biology 2021Quote: ... The plasmid was synthesized by Genscript (Piscataway, New Jersey, USA). The construct was injected into Bloomington Drosophila Stock Center line 27388 and integrated using RMCE by GenetiVision (Houston ...
-
bioRxiv - Pathology 2021Quote: PRR4 cDNA was obtained from ORF clone plasmid (OHu15631, GenScript). PRR4 cDNA without a signal peptide sequence (corresponding to amino acids 17 to 134 ...
-
bioRxiv - Cell Biology 2022Quote: ... Pink1 sgRNAs were designed and cloned to pGS plasmid (Genscript, #1 GCTGGTCCCGGCAAGCCGCG ...
-
bioRxiv - Immunology 2020Quote: ... then cloned into a pUC57-Kan plasmid (GenScript, Piscataway, USA), generating the pUC57-Kan-GP64-casIL-10R1-6H construct ...
-
bioRxiv - Molecular Biology 2021Quote: ... PEn and SpCas9 plasmids were generated by gene synthesis (GenScript). PE2 sequence including the backbone corresponds to the previously published CMV-PE2 construct (Anzalone ...
-
bioRxiv - Neuroscience 2021Quote: ... DYKDDDDK (Flag)-tagged human FAM57B plasmid was purchased from Genscript. Hemagglutinin (HA)-tagged human CerS plasmids were generated as described76.
-
bioRxiv - Genetics 2021Quote: ... HDR templates were ordered in dsDNA form (plasmids) from GenScript or Genewiz ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The plasmid pcDNA3 encoding ACE2 was obtained from GenScript (OHu20260); the plasmid encoding prolactin (PRL ...
-
bioRxiv - Biochemistry 2022Quote: ... For high-level expression we used the pESC plasmid (Genscript) and glucose was substituted for galactose ...
-
bioRxiv - Biochemistry 2022Quote: ... gBlocks were cloned into pUC57-Kanamycin plasmids (Genscript, Rijswijk, Netherlands) by restriction/digestion (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... A codon-optimized bfpD gene in plasmid BfpD-Hcp (GenScript, USA ...
-
bioRxiv - Physiology 2022Quote: ... The WT dynamin-2 mCherry plasmid were constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μg of the industrial grade GFPxm163-pcDNA3.1(+) plasmid (GenScript), 1.5 μL of Lipofectamine 3000 ...
-
bioRxiv - Microbiology 2023Quote: ... eGFP-coding plasmid with T7 promoter was acquired from GenScript. This was linearised by HpaI digestion to be used as a template for in vitro transcription ...
-
bioRxiv - Microbiology 2022Quote: ... the pcDNA3.1+ plasmid encoding TMPRSS2-DYK was purchased from Genscript. All plasmids were sequence-verified before use with Sanger sequencing (Macrogen).
-
bioRxiv - Evolutionary Biology 2023Quote: ... mutagenesis of variants and plasmid cloning were performed by GenScript.
-
bioRxiv - Biophysics 2023Quote: ... and αS ΔNAC: Wild-type plasmids were synthesized from Genscript ® and the rest of the constructs were cloned at Florida State University ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids pMC1249 and pMC1250 were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Physiology 2023Quote: ... mScarlet-tagged versions of these plasmids were generated by GenScript, replacing the sequence encoding dsRed with sequence encoding mScarlet(52) ...
-
bioRxiv - Immunology 2023Quote: ... Heavy chain and light chain plasmids were obtained from GenScript. Expi293 cells (Life Technologies ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding N-terminal domain proteins were obtained from GenScript. Plasmids were transiently co-transfected in FreeStyle 293-F cells using 293Fectin (ThermoFisher) ...
-
bioRxiv - Cell Biology 2023Quote: All plasmids used in this study were synthesized by Genscript. The pAAV-EFS-Cas13d-2A-EGFP plasmid was derived from pXR001 (Addgene ID ...