Labshake search
Citations for GenScript :
651 - 700 of 1218 citations for Mouse Anti Hepatitis B Virus Core Protein Antibody 1822 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... human/mouse codon-optimized genes coding for the identified ChRs were ordered (GenScript, Piscataway ...
-
bioRxiv - Biochemistry 2023Quote: Sequences encoding mouse WT and site-mutated DAG1 were synthesized (GenScript, Piscataway, NJ) and cloned into adeno-associated virus 2/9 (AAV2/9 ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-SUMO (GenScript: A01693) and anti-GST (Abmart ...
-
bioRxiv - Biochemistry 2022Quote: ... anti-His tag (Genscript) or anti-FLAG (Genscript ...
-
bioRxiv - Biochemistry 2022Quote: ... or anti-FLAG (Genscript) antibodies ...
-
African Swine Fever Virus CD2v protein promotes β-Interferon expression and apoptosis in swine cellsbioRxiv - Microbiology 2020Quote: ... anti-Flag (A00187; Genscript) or anti-phosphorylated NF-κB (S536 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti Tbx20 (Genscript). Secondary antibodies were Alexa Fluor 488 goat anti-mouse IgG H+L (Thermo #A11001) ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-V5 from GenScript and anti-GFP from Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then incubated overnight at 4 °C with primary antibodies at 1:100 dilution in PBST and 1 % BSA [SARS-COV-2 Spike S1 antibody (#HC2001 GenScript - #A02038), p62 antibody (#BD 610832) ...
-
bioRxiv - Cell Biology 2019Quote: The proteins were codon optimized for eukaryotic expression and de novo synthesized by GenScript.
-
bioRxiv - Plant Biology 2019Quote: ... 1:500 (produced for this study using full length protein as antigen by GenScript); α-Actin ...
-
bioRxiv - Biochemistry 2020Quote: ... 293T cells were transiently transfected with plasmids expressing SARS-CoV-2 spike protein (GenScript MC_0101081 ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV-2 Spike protein (S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ) was added at concentrations ranging from 0.07 to 500 to nM ...
-
bioRxiv - Immunology 2020Quote: Plasmids encoding cDNAs for hMPV F proteins listed in Table S1 were synthesized (GenScript) and cloned into the pcDNA3.1+ vector ...
-
bioRxiv - Cell Biology 2021Quote: ... 25 μg protein from each sample was mixed with LDS Sample Buffer (M00676, GenScript) and loaded in each well of a 4-20% SurePAGE™ Bis-Tris gel (M00656 ...
-
bioRxiv - Bioengineering 2022Quote: We obtained the genes encoding the designed proteins in pET28a vectors from GenScript (Genscript.com). We confirmed the sequences of all the constructs by DNA sequencing (Eton bioscience ...
-
bioRxiv - Microbiology 2021Quote: ... All the proteins were endotoxin free (ToxinEraserTM Endotoxin Removal Kit, GenScript Biotechnology, Nanjing, China).
-
bioRxiv - Microbiology 2022Quote: ... 10^5 splenocytes were seeded and stimulated with peptides against S protein (From GenScript) (2μg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... gene segment containing spike protein of SARS-CoV-2 wa s synthesized by GenScript Inc ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... fumigatus-optimized fluorescent protein mNeonGreen by using vector pSR25 (synthesized by GenScript, Piscataway, NJ). Primer pairs AtrR-CoNG MH F (CCCGGTCTTCGACACCA ATGGTCCACCCCACGGTGGATTGGCTGGTGCCGGTGCTGGT ...
-
bioRxiv - Biophysics 2022Quote: ... The fusion protein MBP-Q44-HttEx1 was subcloned into a pMalc2x plasmid by Genscript. The protein expression was done in Escherichia coli BL21(DE3 ...
-
bioRxiv - Microbiology 2023Quote: Full-length wMel WalE1 and wAna FtsZ protein-encoding constructs were synthesized by GenScript using codons optimized for E ...
-
bioRxiv - Cell Biology 2023Quote: ... DCP-Bio1-bound proteins were pulled down with Streptavidin-coated magnetic beads (Genscript #L00936) overnight at 4 °C following manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... MgR protein was purified by passing through a column Nickle resin (GenScript Biotech Co.) and washed by using 3 column volumes of wash buffer (50 mM Tris-HCl at pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: The full recombinant MPL36 protein (rMPL36/aa 41-321) was commercially produced by GenScript® Biotech with His-tag in an E ...
-
bioRxiv - Biochemistry 2024Quote: ... Digested product was bound to 500 µL of protein A resin beads (GenScript #L00210) overnight at 4℃ on a rotating shaker ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Microbiology 2024Quote: ... and synthetic fragments and genes encoding the fluorescent proteins from Genscript (Supplementary Table 2).
-
bioRxiv - Biochemistry 2022Quote: ... PVDF membranes were cut and immunoblotted with α-TatA and α-TatB antibodies respectively followed by HRP-conjugated α-rabbit antibody (GenScript). Proteins were visualized using ProSignal Pico ECL Western Blotting detection kit (Genesee Scientific).
-
bioRxiv - Microbiology 2020Quote: ... Primary polyclonal antibodies for Cfp29 were generated by GenScript USA Inc via immunization of rabbits with three peptides from the protein sequence ...
-
bioRxiv - Microbiology 2021Quote: ... and monoclonal antibody (clone ID: 6D11F2) were from GenScript® ...
-
bioRxiv - Molecular Biology 2023Quote: ... A custom RHINO polyclonal antibody was outsourced from GenScript using the recombinant protein described in the “Protein purification section” with 6xHIS tag retained and produced in rabbit (GenScript ...
-
bioRxiv - Plant Biology 2023Quote: Rabbit polyclonal antibodies were obtained from GenScript (NJ, USA). Epitopes were chosen based on the manufacturer’s prediction algorithm results in regions that were covered by the protein sequencing ...
-
bioRxiv - Biochemistry 2022Quote: ... Antibodies were custom-made by GenScript (New Jersey, USA), using the sequences provided in the Supplementary source data.
-
bioRxiv - Microbiology 2023Quote: ... rabbit immunization and antibody purification were conducted by Genscript Co ...
-
bioRxiv - Immunology 2023Quote: ... A SARS-Cov-2 neutralizing monoclonal antibody (GenScript #A02057) was used as a positive control at a starting concentration of 3.2 ng/µL ...
-
bioRxiv - Neuroscience 2023Quote: ... using the High-Affinity Antibody Purification Kit (L00404, GenScript) following the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2023Quote: The guinea pig Zfh1 antibody was generated by GenScript. Recombinant antigen consisting of amino acids 648-775 of Zfh1 isoform PB was produced with an N-terminal His-tag used for purification ...
-
bioRxiv - Microbiology 2024Quote: ... and incubated with a α-HIS antibody (Genscript A00186), followed by HRP-conjugated α-mouse antibody (Abclonal AS003) ...
-
bioRxiv - Microbiology 2024Quote: ... A custom primary antibody for Imp1 (α-Imp1, Genscript), a commercial primary FLAG antibody (α-FLAG ...
-
bioRxiv - Genomics 2024Quote: ... The polyclonal antibody was purified by affinity column (GenScript). No cross reactivity against the host cell lysates was seen by western blots (Supplementary figure 13B) ...
-
bioRxiv - Cell Biology 2020Quote: To generate pLenti-mTomm70A-EGFP the open reading frame of mouse Tomm70A (GenScript OMu13526) was amplified via PCR and inserted into pcDNA-EGFP introducing a ten amino acid long linker between mTomm70A and EGFP (GGSGDPPVAT) ...
-
bioRxiv - Cell Biology 2020Quote: ... To generate pLenti-mTimm50-mRFP the open reading frame of mouse Timm50 (GenScript OMu13400) was amplified via PCR and inserted into pcDNA-mRFP introducing a ten amino acid long linker between mTimm50 and mRFP (GGSGDPPVAT) ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse alpha-DG N terminal domain(a-DGN) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Biophysics 2020Quote: The cDNA sequences for the protein variants used in the study were purchased from GenScript and the proteins were N-terminally tagged with a 6xHis-Lipo domain ...
-
bioRxiv - Immunology 2021Quote: ... GST-tagged NSUN2 proteins were purified by affinity chromatography using reduced glutathione resin (GenScript, L00206) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: Codon-optimized open reading frames for EuRe and BoMoC RT proteins were ordered from GenScript. Proteins were produced in Escherichia coli by expression from MacroLab vector 2bct with a C-terminal 6xHis tag (https://qb3.berkeley.edu/facility/qb3-macrolab/#facility-about ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV2 Spike protein (100 nM, S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ), EG00229 (Cat#6986 ...
-
bioRxiv - Biochemistry 2021Quote: ... 15 μg total protein was loaded and resolved on Bis-Tris 4-12% gels (GenScript) and transferred to a polyvinylidene difluoride (PVDF ...