Labshake search
Citations for GenScript :
501 - 550 of 896 citations for Mouse Anti Dengue Virus NS1 Serotype 3 Antibody CC6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Anti-His-HRP (Genscript, A00612), Avidin-HRP (Biolegend ...
-
bioRxiv - Biochemistry 2020Quote: ... goat anti-rabbit/HRP (Genscript) and rabbit anti-mouse/HRP (DAKO)-conjugated secondary were incubated with the blots to detect GBA2 (rabbit polyclonal antibodies ...
-
bioRxiv - Neuroscience 2020Quote: Goat polyclonal anti-GAPDH (GenScript), chicken polyclonal anti-MAP2 (EnCor Biotech ...
-
bioRxiv - Microbiology 2022Quote: ... or anti-streptavidin (STII GenScript rabbit anti-NWSHPQFEK polyclonal antibody ...
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-Myc-HRP (Genscript, A00863) and SYTOX™ Blue Dead Cell Stain (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... anti-His (1:4,000) (GenScript), anti-GFP (1:10,000 ...
-
bioRxiv - Plant Biology 2023Quote: ... anti-beta Actin [HRP] (GenScript), anti-DspE50 ...
-
bioRxiv - Biochemistry 2023Quote: ... immunoblotted with anti-DYKDDDK (Genscript) and Mouse IgG HRP-linked whole Ab (Cytiva) ...
-
bioRxiv - Biochemistry 2023Quote: ... and anti-V5 (A01724, Genscript) antibodies with the inputs loaded at 5 %.
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Systems Biology 2021Quote: ... The +1 nucleotide was mutated to all other nucleotides (G, C or T) and these 3 mutant plasmids were synthesized into DNA oligos and cloned by Genscript.
-
bioRxiv - Biochemistry 2022Quote: The gene encoding SARS-CoV-2 NSP3 Mac1 (residues 3-169) was cloned into a pET-22b(+) expression plasmid with a TEV-cleavable N-terminal 6-His tag (Genscript). The protein was expressed and purified as described previously (14).
-
bioRxiv - Biochemistry 2021Quote: ... The cell debris was removed by centrifuging at 16000 rpm for 30 min and the supernatant was loaded onto 3 mL of Ni-NTA resin (Genscript). A gravity flow Ni-NTA chromatography was performed ...
-
bioRxiv - Genetics 2022Quote: The HTP-3 antibody used in this study was generated from an identical C-terminal segment of the HTP-3 protein (synthesized by GenScript) as was used by (MacQueen et al ...
-
bioRxiv - Immunology 2022Quote: ... according to the manufacturer’s instructions and plated in 24 well tissue culture plates at 3×106/well in in the presence of OT-I peptide (GenScript) and the following cytokines ...
-
bioRxiv - Microbiology 2022Quote: ... plasmid pUC57-KRV-9000-11375 containing part of NS5 gene and the 3’ UTR of KRV (nt 9000-11375) was synthesized by GenScript.
-
bioRxiv - Immunology 2020Quote: ... zooepidemicus lacking the N-terminal signal seqence was synthesized and cloned into pGEX-6P-3 expression vector using BamHI and SalI restriction sites (Genscript). E ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fluorogenic peptide cleavage assays were performed at 37 ° C with 1 μM coreAFG3L2WB or its variants and 50 uM peptide (Leu-(3-NO2-Tyr)-Phe-Gly-(Lys-Abz)) (GenScript) in a 384-well black plate using SpectraMax M5 plate reader (ex = 320 nm ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Biochemistry 2022Quote: ... middle and bottom of the gradient were collected and 15 μL of each were mixed with 4 μL 4x loading buffer and heated for 3 mins before SDS-PAGE gel electrophoresis (SurePAGE 10% Bis-Tris, GenScript).
-
bioRxiv - Genomics 2022Quote: ... a 9 base pair(bp)’Spatial barcode A’,(3) a 12bp anchor sequence(/AmC6/CTACACGACGCTCTTCCGA-Spatial barcode A-ACTGGCCTGCGA) (Genscript). To enlarge the barcode pool ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Neuroscience 2022Quote: ... A matching clone in which all TAG triplets in the 3’-UTR were mutated to TGA to disrupt the Musashi binding sites was created using gene synthesis (Genscript). Gibson assembly was used to reclone the cDNAs into pcDNA3.1(+ ...
-
bioRxiv - Developmental Biology 2023Quote: Pre-validated gRNA sequences targeting the exon 3 of BMP4 or BMP7 gene were obtained from genome-wide databases provided by GenScript (https://www.genscript.com/gRNA-database.html ...
-
bioRxiv - Molecular Biology 2023Quote: ... and either amplified from a clinical isolate (FR-3 and Muc) and cloned into a modified pUC19 backbone (fragments A-D) or de novo synthesized (GenScript) and cloned into a pUC57 backbone (fragments A-C).
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... Selected mouse IgG and IgK chains were cloned into humanized IgH and IgL vectors (Genscript).
-
bioRxiv - Developmental Biology 2023Quote: ... Dlx5 and Pbx1 coding sequences were amplified from mouse cDNA and cloned into pcDNA3.1 (Genscript). Meis2 vector was mutated with NEBuilder HiFi DNA Assembly kit (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were analyzed by SDS-PAGE and immunoblotting with anti-Flag (anti-DYKDDDDK, Genscript), anti-HA (clone 3F10 ...
-
bioRxiv - Microbiology 2021Quote: ... Polyclonal antibodies against OVA or SV40 were obtained from GenScript (GenScript ...
-
bioRxiv - Microbiology 2021Quote: ... for SyNOS and a specific OtNOS antibody generated by GenScript Company.
-
bioRxiv - Microbiology 2019Quote: Peptide antibodies to the six TIPs were generated by GenScript using their standardized work flow ...
-
bioRxiv - Neuroscience 2021Quote: We used the following primary antibodies: NEEP21/NSG1 (Genscript A01442), FAM21 (Millipore ABT79) ...
-
bioRxiv - Microbiology 2022Quote: ... and polyclonal αcGAS antibodies were purified by antigen affinity (GenScript). Serum was used at 1:30,000 for cGAS detection ...
-
bioRxiv - Biophysics 2023Quote: ... The His-Tag antibody (Cat# A00186S, GenScript, New Jersey, US) for 2h at RT ...
-
bioRxiv - Immunology 2023Quote: ... Antibodies were purified with Protein A magnetic beads (GenScript, L00273). Expression vectors for CoV-2196 ...
-
bioRxiv - Immunology 2023Quote: Antibody heavy and light chain genes were synthesized by GenScript, separately inserted into vector plasmids (pCMV3-CH ...
-
bioRxiv - Evolutionary Biology 2024Quote: The rabbit antibody for Shavenbaby (Svb) was produced by GenScript against the following amino acid sequence:
-
bioRxiv - Immunology 2023Quote: ... THETM V5 Tag antibody (both at 1:5000 dilution, GenScript), and CLIPA8 primary antibody (1:5000 dilution ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Microbiology 2021Quote: ... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with an empty vector (PC) or a vector against Bach1 with the following gRNA 5’ GCGGTTCCGAGCCCACCGCT 3’ (GenScript Biotech Corporation, USA) (BACH1 KO ...
-
bioRxiv - Biophysics 2019Quote: ... His-tagged Xenopus laevis HAUS8 was used to produce rabbit polyclonal anti-HAUS8 anti-serum (Genscript). Alexa-647 labelled XenC antibody was generated by first dialyzing antibodies in PBS buffer (50mM NaPO4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... anti-GFP (1:1000) (GenScript, A01704) anti-MRG-1 (1:1000 ...
-
bioRxiv - Plant Biology 2022Quote: ... rabbit anti-histone H3 (A01502, GenScript), and rabbit anti-PEPC (100-4163 ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-total H3 (GenScript, 2.5 µL), anti-H3K4me2 (Millipore 07-030 ...
-
bioRxiv - Microbiology 2020Quote: ... THE™ Anti-His-HRP (Genscript).