Labshake search
Citations for GenScript :
1 - 50 of 151 citations for Medium Kit without Serum and with CultureBoost R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: Synthetic RNA oligonucleotides with/without Nm were obtained from GenScript Biotech Co. ...
-
bioRxiv - Microbiology 2022Quote: ... mutant A and mutant B without signal peptides were synthesized by GenScript USA ...
-
bioRxiv - Neuroscience 2023Quote: ... FAM19A5 (NM_001252310.1) without tags was subcloned and inserted into the pcDNA3.1 vector (GenScript). The ectodomain (30-1263 ...
-
bioRxiv - Immunology 2021Quote: Pseudo-neutralization assays were performed on hamster serum using the cPassTM Neutralization Antibody Detection kit (GenScript).
-
bioRxiv - Immunology 2020Quote: ... human recombinant IL-2 (10 U/well) and with or without SIINFEKL peptide (Genscript) at 0.2ug/ml ...
-
bioRxiv - Biochemistry 2021Quote: ... the cells were transfected with pcDNA3.1-spike-V5 with or without pcDNA3.1-GALNTs-FLAG (Genscript) using Lipofectamine 3000 reagent (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Serum LPS concentrations were measured with a ToxinSensor Chromogenic Limulus Amebocyte Lysate (LAL) Endotoxin Assay Kit (GenScript, Piscataway, NJ), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: The TTHA0766 gene from Thermus thermophilus HB8 was synthesized without a periplasmic target sequence by GenScript and the plasmid encoding cpGFP was kindly provided by Wolf Frommer ...
-
bioRxiv - Neuroscience 2019Quote: ... bromophenol blue) without reducing agent before loading onto a 4-16% PAGE gel (GenScript ExpressPlus™). Gels were blotted on PVDF membranes and fixed in 4% formaldehyde for 30 minutes and boiled in PBS for 5 minutes ...
-
bioRxiv - Immunology 2021Quote: ... human recombinant IL-2 (10 U/well) and with or without NP311 or NP366 peptides (Genscript) at 0.2ug/ml ...
-
bioRxiv - Immunology 2021Quote: Levels of neutralizing antibodies in serum samples were determined by cPASSTM SARS-CoV-2 neutralization antibody detection kit (GenScript, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: The neutralizing activity of mouse serum samples was detected by SARS-CoV-2 Surrogate Virus Neutralization Test Kit (L00847A, GenScript). Detections were performed according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2019Quote: ... the Leo CDS without the signal sequence (67 to 564-bp of ACA1_074730) was codon optimized (GenScript) and cloned into pMAL-p2x vector ...
-
bioRxiv - Biochemistry 2023Quote: ... and H2A.Z N-terminal tail peptides with and without modifications were purchased from GenScript (Piscataway, NJ, USA). Amino-acid sequence information of each peptide is available in Table 1 ...
-
bioRxiv - Immunology 2020Quote: Neutralization experiments on serum samples of immunized animals and convalescent patients were performed as per the manufacturer protocol (sVNT Kit, GenScript, USA). Briefly ...
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of pseudovirus infection of cells containing SARS-CoV-2 receptors was performed on serum specimens using two commercially available SARS-CoV-2 LVV-PsN Kit (SC2087A; SC2087L; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of ACE2 binding to SARS-CoV-2-RBD was performed on serum specimens using a commercially available SARS-CoV-2 sVNT Kit (L00847; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... recombinant human ACE2-IgG-Fc fragments (r-hACE2-Fc) (GenScript, Z03516) were firstly incubated with the Protein-G agarose (Millipore ...
-
bioRxiv - Biochemistry 2022Quote: ... two polypeptides with the sequence MQDDLLMDKSKTGGGGASSSWNTHQ (with and without an N-terminal Dansyl group) were also obtained from Genscript. All the peptides were over 95% pure ...
-
bioRxiv - Biophysics 2021Quote: A plasmid expressing mature OmpA without the 22 amino acid signal sequence in the pET303 vector was purchased from Genscript for cloning of the modified loop constructs ...
-
bioRxiv - Microbiology 2019Quote: ... the dissected thrips tissues that were only incubated with secondary antibody (without adding primary antibody) and the tissues incubated with each pre-immune mouse antiserum (GenScript) were used as negative controls ...
-
bioRxiv - Molecular Biology 2022Quote: ... and recombinant mouse IL11 (rmIL11, UniProtKB: P47873) were synthesized without the signal peptide using a mammalian expression system by Genscript.
-
bioRxiv - Microbiology 2022Quote: ... Polyclonal serum against Gn was raised commercially (GenScript) by immunisation of rabbits with a synthetic peptide (Gn residues 99–112 ...
-
bioRxiv - Microbiology 2020Quote: ... the cDNA for PbChiB2 (Fig. S1) and PbChiB4 (Fig. S1) without the signal peptide was synthesized and cloned into plasmid pET-14b (GenScript, USA). Plasmids were used to transform E ...
-
bioRxiv - Immunology 2023Quote: ... and cloned into the CMV/R vector (Barouch et al. 2005) by Genscript with a C-terminal hexahistidine affinity tag ...
-
bioRxiv - Genomics 2024Quote: ... were synthesized de novo and cloned into pUC57 Kan-r (GenScript, Piscataway NJ) as entry vectors suitable for Gateway cloning (72) ...
-
bioRxiv - Genetics 2023Quote: The RNase R sequence from Mycoplasma genitalium (accession number: WP_009885662.1) was synthesized by GenScript Biotech Co ...
-
bioRxiv - Genetics 2024Quote: ... the Schneider’s medium was replaced by Schneider’s medium containing 100 ng/mL of different synthesized Drosophila neuropeptides (Genscript, the sequences of the peptides are shown in Supplementary Table 2) ...
-
bioRxiv - Biochemistry 2020Quote: ... Antibodies: Mouse pre-immune serum and antiserum after 3rd immunization (GenScript) was used 1:1000 ...
-
bioRxiv - Biochemistry 2022Quote: ... The primary antibody (rabbit anti-ScV-L-A peptide serum by GenScript) was diluted at 2:25000 in 2% (w/v ...
-
bioRxiv - Microbiology 2020Quote: ... with all lysine residues predicted facing the cytoplasm mutated (TbAQP25K>R) was designed and synthesized by GenScript and verified by sequencing ...
-
bioRxiv - Immunology 2020Quote: ... and IgA antibodies in the rhesus serum standard: anti-S1 RBD (Genscript #HC2001), anti-S2 (SinoBiologicals #40590-D001 ...
-
bioRxiv - Molecular Biology 2021Quote: A construct containing the lysine (K) to arginine (R) mutations within Apl5 PASK cluster was created custom by GenScript and used for the experiments listed in Supplemental Fig 1 and Supplemental Fig 2 ...
-
bioRxiv - Neuroscience 2023Quote: ... An IgG2b expression plasmid encoding the K89/34 IgG2b R-mAb was generated to order by Genscript (https://www.genscript.com/) by replacing the mouse IgG2a (ψ2a ...
-
bioRxiv - Molecular Biology 2020Quote: The EPYC1 full-length gene (encoding amino acids 1-317) and corresponding R/K mutant (EPYC1R64A/K127A/K187A/K248A/R314A) were synthesized by GenScript and cloned between the SacII and HindIII site of the pHue vector48 ...
-
bioRxiv - Immunology 2020Quote: ... Genes for expression of HA fusions to nanoparticle trimeric components were codon optimized for expression in human cells and cloned into the CMV/R (VRC 8400) mammalian expression vector by Genscript. All HA fusions to the I53_dn5B trimer contained full-length HA ectodomains including native secretion signals ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This gene was codon optimized for human cell expression and made in the CMV/R mammalian expression vector by Genscript. Transient transfection into HEK293F cells was carried out using PEI MAX ...
-
bioRxiv - Immunology 2023Quote: ... and were codon-optimized for human cell expression and made in the CMV/R vector (Barouch et al. 2005) by Genscript with a C-terminal hexahistidine affinity tag ...
-
bioRxiv - Cell Biology 2023Quote: ... and the primers covering SNPs in the Cth (F- GAGCCTGGGAGGATATGAGA, R- AAGCTCGATCCAGGTCTTCA) and Ttc4 (F – GACAGGGCGGAACTATACCA, genes. qPCR products were Sanger sequenced using the GenScript Biotec Sanger sequencing service.
-
bioRxiv - Neuroscience 2023Quote: ... SnifferOT cells were transiently transfected to express the red fluorescent genetically encoded calcium indicator R-GECO (GenScript, Piscataway, NJ, USA) with Fugene HD reagent (Promega ...
-
bioRxiv - Microbiology 2019Quote: ... Bands were identified using a commercial polyclonal serum against the histidine tag (#A00186-100 Genscript) and an anti-mouse secondary antibody (#170-6516 ...
-
bioRxiv - Immunology 2020Quote: ... Test serum (1:100 dilution) or the mAb 5B7D7 (1 µg/ml) (GenScript, Piscataway, NJ) was diluted in CSA buffer and incubated for 1 hour at room temperature with 0.1 µg/mL RBD-Fc (BPS Bioscience ...
-
bioRxiv - Biophysics 2019Quote: ... His-tagged Xenopus laevis HAUS8 was used to produce rabbit polyclonal anti-HAUS8 anti-serum (Genscript). Alexa-647 labelled XenC antibody was generated by first dialyzing antibodies in PBS buffer (50mM NaPO4 ...
-
bioRxiv - Immunology 2020Quote: ... splenocytes were cultured in RPMI-1640 supplemented with 10% fetal bovine serum in the presence of 1 ug/ml of LCMV-gp peptide (Genscript) and 5 ug/ml of Brefeldin A (Biolegend ...
-
bioRxiv - Immunology 2020Quote: ... A second serum aliquot was tested with a surrogate virus neutralization test that detects isotype-independent RBD neutralizing antibodies (cPass, GenScript) (18) ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Medium was collected 7 days post-transfection and mAbs were purified using protein A resin (Genscript) affinity chromatography and eluted in PBS (pH 7.4) ...
-
bioRxiv - Immunology 2024Quote: ... Heat 500 μl of mouse serumat 56℃ and then incubated the heated serum with 1 ml of washed Protein-G resin (GenScript L00209) overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.