Labshake search
Citations for GenScript :
1 - 50 of 598 citations for Mac 1 SAP rat Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: cDNA constructs for expression of recombinant Mac-1 in mammalian cells were generated by GenScript. ITGAM cDNA was cloned into the vector pcDNA3.1/HygroB(+) ...
-
bioRxiv - Cell Biology 2022Quote: ... rat-anti-Sasshort (1:50, GenScript USA Inc.); mAb Cq4 against crumbs (1:100 ...
-
bioRxiv - Biophysics 2023Quote: ... and 10 μM rat 26RFa (GenScript) were added into the cell lysis and incubated at room temperature (RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-sera obtained from immunized rats (Genscript).
-
bioRxiv - Neuroscience 2021Quote: cDNA encoding rat NBCe2 was purchased from GenScript and subcloned into the oocyte expression vector pXOOM ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-rat kangaroo-Kid (3μg/ml, Genscript). The anti-rat kangaroo Kid was raised against the full Kid protein translated from the coding sequence obtained from the PtK transcriptome (Udy et al. ...
-
bioRxiv - Cancer Biology 2019Quote: Custom rat anti-KRAS4A antibody was developed by Genscript using the peptide sequence CEIRQYRLKKISKEEK as antigen for immunization..
-
bioRxiv - Bioengineering 2022Quote: ... The rat Arc 5’ UTR sequence was synthesized by Genscript. Molecular cloning techniques (PCR amplification ...
-
bioRxiv - Neuroscience 2020Quote: ... Rat granulocyte colony stimulating factor (G-CSF) was purchased from GenScript Corp (Piscataway NJ ...
-
bioRxiv - Immunology 2022Quote: Immunization of Wistar rats for hybridoma generation was conducted by GenScript USA ...
-
bioRxiv - Cell Biology 2019Quote: ... Rat polyclonal antibodies against full-length recombinant GST-tagged PfAlba3 were from GenScript Corporation ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Human C-type natriuretic peptide (CNP) and rat atrial natriuretic peptide (ANP) were from GenScript Corp ...
-
bioRxiv - Immunology 2022Quote: ... The purified protein was used to immunize Wistar rats to generate a panel of monoclonal antibodies by Genscript USA ...
-
bioRxiv - Microbiology 2023Quote: The full-length genomic sequence of the LCK-3110 strain of rat HEV (Genbank MG813927.1) was artificially synthesized (Genscript). The plasmid pSP64 poly (A ...
-
bioRxiv - Immunology 2023Quote: ... a biotinylated rat polyclonal antibody against human Fc was used as a capture antibody and anti-human IgG Fc-HRP (GenScript Cat# A01854-200) as a detection antibody ...
-
bioRxiv - Cell Biology 2020Quote: The endotoxin level of FHL-1 recombinant protein preparations was measured using the Toxin Sensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, NJ, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Pathology 2022Quote: ... Jagged-1 peptide (1 uM, Genscript), Y-27632 (10 uM ...
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Genetics 2021Quote: ... rat anti-RAD-51 (1:500, (20)), guinea pig anti-SUN-1 S24pi (1:700, (72)), chicken anti-GFP (1:500, (A01694, Genscript)) ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti α-Tubulin (Genscript, 1:50-1:100); Anti α-Tubulin (proteintech ...
-
bioRxiv - Genomics 2023Quote: ... with CloneEZ PCR Cloning Kit (GenScript #L00339). The pLenti-GIII-EF1α-CBX3-Flag-HA ...
-
bioRxiv - Immunology 2023Quote: ... the commercialized ELISA kit (Genscript, Cat#L00871) was used ...
-
LIR-dependent LMX1A/LMX1B autophagy crosstalk shapes human midbrain dopaminergic neuronal resiliencebioRxiv - Cell Biology 2019Quote: ... anti-FLAG (Genscript, A00187: IB, 1:1500; IF, 1:300); anti-GAPDH (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... anti-SpoVAD64 (1:10,000) and anti-His (1:4,000) (GenScript) antibodies ...
-
bioRxiv - Developmental Biology 2020Quote: ... Dkk-1 (GenScript) was added to BM at final concentration of 100 ng/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... FAT-1 (Genscript), and FAT-2 (Genscript ...
-
bioRxiv - Genomics 2021Quote: ... Ada2b (rabbit polyclonal, 1:1000; GenScript anti-amino-acid 1-330); anti-Flag-horseradish peroxidase (mouse ...
-
bioRxiv - Microbiology 2022Quote: The ToxinSensor Chromogenic LAL Endotoxin Assay kit (GenScript) was used to determine endotoxin units/mL of culture ...
-
bioRxiv - Neuroscience 2024Quote: ... a toxin Eraser endotoxin removal kit (#L00338, Genscript) with a high efficiency endotoxin removal resin was employed ...
-
bioRxiv - Neuroscience 2021Quote: ... plko.1-CMV.Puro-tGFP-shFoxg1 or plko.1-CMV.Puro-tGFP-shLuciferase (Genscript) plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... 1:100 (A00487, Genscript). All secondary antibodies were purchased from Invitrogen and used at 1:700 and were Alexa Fluor-488 Donkey anti-rabbit (A21206) ...
-
bioRxiv - Immunology 2022Quote: ... β-Actin (GenScript, 1:15,000), T-bet (clone 4B10 Santa Cruz ...
-
bioRxiv - Immunology 2022Quote: ... β-actin (GenScript, 1:15,000), goat anti-mouse (Jackson Immunoresearch ...
-
bioRxiv - Neuroscience 2023Quote: ... using the High-Affinity Antibody Purification Kit (L00404, GenScript) following the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2020Quote: ... 1-932 and EAV nsp9 1-693 was synthesized with codon optimization (Genscript) and cloned into pFastBac with an N-terminal MG addition and C-terminal TEV protease site and two Strep tags ...
-
bioRxiv - Microbiology 2022Quote: ... α-CrPV-VP2 (1:1000, Genscript), α-CrPV-3C (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... S1 (GenScript, Cat # Z03485-1) and RBD (aa 319-591 ...
-
bioRxiv - Cell Biology 2020Quote: ... FLAG (A00187, GenScript (1:1,000)) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:7,500 (GenScript, A01827-200) and ECL2 detection steps ...
-
bioRxiv - Microbiology 2023Quote: ... anti-His (1:4,000) (GenScript), anti-GFP (1:10,000 ...
-
bioRxiv - Biochemistry 2023Quote: ... Strep (Genscript A01732, 1: 5,000), c-myc (Invitrogen 13-2500 ...
-
bioRxiv - Bioengineering 2023Quote: ... 1 mM RGD peptide (GenScript) was added to the precursor solution ...
-
bioRxiv - Bioengineering 2020Quote: ... and measured by ToxinSensor Chromogenic LAL Endotoxin Assay Kit (Genscript). The purified Nbs were further sterilized by passing a 0.2 μm filter (Millex ...
-
bioRxiv - Immunology 2020Quote: For the surrogate neutralization assay the cPass kit from GenScript was used (Cat ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... ToxinSensor Gel Clot Endotoxin Assay Kits were purchased from GenScript. VacciGrade LPS was purchased from InvivoGen.