Labshake search
Citations for GenScript :
501 - 550 of 929 citations for MBL 2 MBP C Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: The L1 gene fragment sequences of human papillomavirus (HPV) types 16 and 18 were incorporated into the pCDNA3.1(+) plasmid by Genscript. To amplify the specific regions of interest ...
-
bioRxiv - Biochemistry 2023Quote: The DNA sequence of pancreatic human GCK (Ensembl ENST00000403799.8) was codon optimized for yeast and cloned into pDONR221 (Genscript). Selected missense variants were generated by Genscript ...
-
bioRxiv - Microbiology 2023Quote: ... HA sequence was used to construct a human codon-optimized gene which was synthesized and cloned into the BamHI and EcoRI sites of pcDNA3.1+ by GenScript. The SARS-CoV-2 spike gene (Wuhan ...
-
bioRxiv - Biophysics 2024Quote: The hKir2.1 cDNA gene coding the sequence of human Kir2.1 was cloned into the mammalian expression vector pMT3 containing an Ampicillin resistance gene (GenScript). Kir2.1 pathological mutants (C154Y ...
-
bioRxiv - Immunology 2024Quote: Cognate VH and VL antibody sequences of interest were synthesized and cloned into a customized pcDNA 3.4 vector containing a human IgG1 Fc region by GenScript Biotech ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Microbiology 2021Quote: ... polyclonal anti-Bma-LAD-2 peptide antibodies were generated by Genscript. Rabbits were immunized with Bma-LAD-2 peptide sequences conjugated to keyhole limpet hemocyanin (KLH) ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding SARS-CoV-2 and other coronavirus S-2P (Genscript) were transiently transfected in FreeStyle 293-F cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Codon-optimized spike of SARS-CoV-2 was purchased from GenScript and subcloned to pcDNA3.1 ...
-
bioRxiv - Microbiology 2022Quote: ... An anti-SARS-2 nucleocapsid protein rabbit antiserum (generated by GenScript) was used at a 1:1000 dilution to detect specific anti–SARS-2 immunoreactivity using the Discovery ULTRA automated staining instrument (Roche Tissue Diagnostics ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein-crud (RP30020, GenScript Biotecn Corp). A ten amino acid overlapping peptide mixture pool was prepared ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 N and S1 proteins were obtained from Genscript and Sino Biological.
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 spike gene (Wuhan) was synthesized by Genscript for Dr ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 2 mL of nickel resin (GenScript) at RT for 20 minutes and washed once with lysis buffer and another three times with wash buffer (20 mM Tris-Cl pH8.8 ...
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and ligated in place of the C terminus of the full-length CLEC16A isoform construct (OHu18264D; Genscript). To generate the CLEC16A mutant bearing only the internal deletion of the CLEC16A disease isoform ...
-
bioRxiv - Neuroscience 2019Quote: ... a siRNA sequence targeting the SULT4A1 C-terminus was designed following GenScript siRNA Target Finder instructions (GenScript). Nucleotide sequence ...
-
bioRxiv - Microbiology 2021Quote: ... Monoclonal anti-CodY antibody was generated by injection of CodY into the BALB/C mouse (Genscript, USA). Mouse anti-CodY IgG monoclonal antibody (IgG ...
-
bioRxiv - Biophysics 2021Quote: ... and cloned into pET28b expression vectors with a C-terminal 6x histidine-tag (6xHis-tag) by Genscript USA Inc ...
-
bioRxiv - Biochemistry 2022Quote: The 10 C-terminal residues of Caulobacter crescentus RNase E (EKPRRGWWRR) (GWW peptide) were synthesized by GenScript with C-terminal amidation and dissolved in Milli-Q water ...
-
bioRxiv - Immunology 2022Quote: ... the following pairs of primary antibodies were used: 1) TCRα-TCRβ crosslinking: rabbit anti-c-Myc (Genscript) and mouse anti-V5 (Genscript) ...
-
bioRxiv - Biophysics 2022Quote: The C terminal domain of Influenza A Matrix protein 1 (M1C) was subcloned into pET15b vector (GenScript). In addition to the M1C sequence ...
-
bioRxiv - Neuroscience 2022Quote: ... XM:006510629.3 ORF sequence) cDNAs cloned into the pcDNA3.1+/C-(k)-DYK vectors were obtained from GenScript. For the electrophysiological recordings of the Na+ currents ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were transiently transfected with a pcDNA3.1 vector that expressed a C-terminally Flag-tagged AFG3L2 (GenScript) with the indicated single-point mutations ...
-
bioRxiv - Biochemistry 2019Quote: ... P116A/Y117Q and P142A/Y143Q mutants with a C terminal FLAG tag were synthesized by Genscript (genscript.com).
-
bioRxiv - Immunology 2019Quote: 96-well ELISA plates were coated overnight at 4°C with mouse anti-Avi-tag antibody (Genscript) at 2 μg/ml in PBS ...
-
bioRxiv - Biochemistry 2021Quote: The pcDNA3.1(+) plasmid encoding the C-terminally 3xFLAG-tagged MTG1 (UniProt ID Q9BT17) was ordered from GenScript. The inserted sequence was verified using a CMV forward primer at Microsynth ...
-
bioRxiv - Immunology 2020Quote: ... with a plasmid containing the complete human ACE2 transcript variant 1 cDNA sequence (NM_001371415.1) cloned into the mammalian expression vector pcDNA3.1-C’ FLAG by Genscript. Cells were grown in Iscove’s Modified Dulbecco’s Medium (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: FLAG-tagged (FT)-Tg in pcDNA3.1+/C-(K)-DYK plasmid was purchased from Genscript (Clone ID OHu20241). Site-directed mutagenesis was then performed to engineer FTG2341R ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the C-terminal DYK sequence of the DNase1L3 protein coding sequence from the DNase1L3_OHu20141D_pcDNA3.1+/C-(K)-DYK plasmid (Genscript). The obtained sequence was then inserted into the pmEGFP-N1 vector to construct DNase1L3ΔNT-EGFP ...
-
bioRxiv - Neuroscience 2023Quote: ... the complete open reading frame of mouse NaV1.7 was cloned into the pcDNA3.1(+)-C-DYK vector (GenScript) with several modifications ...
-
bioRxiv - Physiology 2024Quote: ... Human HSD17B13 (NCBI Accession number: NM_178135.5) with HA-tag on the C-terminus was cloned into pcDNA3.1 (Genscript). HEK293 cells and HepG2 cells were transfected with HSD17B13 or empty control vector using Lipofectamine 2000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... XPA expression plasmids contain full-length human XPA (NM_000380) with the indicated mutations in the pcDNA3.1(+) backbone (GenScript custom order).
-
bioRxiv - Bioengineering 2020Quote: Codon-optimized forms of human ACE2 binding region (amino-acids 19-615) and modified ACE2 genes were chemically synthesized (Genscript), and were subcloned upstream of a human Fc region (derived from IgG1 ...
-
bioRxiv - Biochemistry 2021Quote: ... The H4 substrate peptide used in the assay corresponds to the first 19 residues of human H4 (NH2-SGRGKGGKGLGKGGAKRHR-COOH; GenScript). In the assay ...
-
bioRxiv - Biochemistry 2021Quote: ... sequences with codons optimized for expression in human cells were synthesized and cloned into pHLSec between AgeI/KpnI by Genscript. The constructs were co-transfected with Furin-encoding plasmid ...
-
bioRxiv - Immunology 2021Quote: ... Plates were washed three times with PBS-T (PBS with 0.1% Tween-20) and 50 μl of HRP anti-Human IgG Antibody (GenScript #A00166) diluted 1:5000 in dilution solution were added to each well ...
-
bioRxiv - Microbiology 2021Quote: ... NS3/4A expression vector was generated by subcloning a synthetic gene which was codon optimized for expression in human cells (Genscript) into the pCI plasmid ...
-
bioRxiv - Molecular Biology 2022Quote: ... The coding sequences of human UBXN1 (Uniprot identifier Q04323-1) and FAF2 (Uniprot identifier Q96CS3-1) were synthesized by GenScript Biotech ...
-
bioRxiv - Cell Biology 2022Quote: ... The primary antibody against Ft-L was made using recombinant human Ft-L subunit as antigen by GenScript (Nanjing, China).
-
bioRxiv - Microbiology 2020Quote: The IgG heavy and light chain variable genes of CB6 mAb (GenBank: MT470196 and MT470197) were human codon-optimized and synthesized by Genscript and cloned into antibody expression vectors.
-
bioRxiv - Systems Biology 2020Quote: Clones were either collected from the human Orfeome 3.1 and 8.1 clone libraries (full length clones) or ordered as synthetic genes from Genscript (RBP constructs). As in our previous work (Jolma et al ...
-
bioRxiv - Microbiology 2021Quote: ... RBD-binding peptide SBP1 derived from human ACE2 α helix 1 (Ac-IEEQAKTFLDKFNHEAEDLFYQS-NH2) was synthesized by GenScript (Nanjing, China).
-
bioRxiv - Immunology 2022Quote: ... Bound IgG was detected as the luminescence signal at 425 nm using an HRP-conjugated anti-human IgG (H&L) secondary antibody (Genscript) and SuperSignal ELISA Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific).
-
bioRxiv - Biophysics 2020Quote: ... The plasmid encoding full-length human DAP5 with an N-terminal 6x-histidine tag was purchased from Genscript (Piscataway, NJ). All the proteins were recombinantly expressed in E ...
-
bioRxiv - Neuroscience 2019Quote: ... The following reagents or cell lines were used in this study: a human Aβ42 peptide (GenScript, Nanjing, China, cat# RP10017), the Dicer1 siRNA duplex and the negative control (NC ...