Labshake search
Citations for GenScript :
1 - 50 of 512 citations for L Valine 13C5 95 97%; 15N 96 99%; 2 3 D2 97%+ since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... Region +95 to +374 containing (linker-Spinach 2-linker-Spinach 2-linker) was synthesized by GenScript as double stranded DNA delivered on a pUC57 plasmid ...
-
bioRxiv - Microbiology 2022Quote: ... purified to >95% (GenScript), and confirmed to be metal-free by ICP MS ...
-
bioRxiv - Microbiology 2021Quote: ... and ChIP (Genscript >95% purity) was dissolved in H2O ...
-
bioRxiv - Bioengineering 2019Quote: Scrambled RDG peptides (GRDGSPC; >95% purity; GenScript) were labeled with DyLight 755 NHS ester (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Peptides were synthesized at >95% purity (Genscript, USA).
-
bioRxiv - Neuroscience 2023Quote: Synthetic peptides (>95% pure) were obtained from GenScript. YGRKKRRQRRR was used as the Tat sequence ...
-
bioRxiv - Bioengineering 2019Quote: ... protease-degradable cross-linking peptide (GCRDVPMSMRGGDRCG; >95% purity; GenScript) dissolved in PBS containing 10 mM HEPES was mixed with the PEG-4MAL precursor solution containing Wnt7a and polymerized at 37 °C for 5 min.
-
bioRxiv - Biochemistry 2020Quote: Synthetic peptides (lyophilized, >95% purity) were obtained from Genscript, Inc ...
-
bioRxiv - Neuroscience 2019Quote: ... which is 99% similar to the mouse version was synthesized by Genscript and cloned into the pAAV-hSyn-LMO3 plasmid to replace the hSyn promoter ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Bioengineering 2019Quote: ... The VHPKQHR(MiniPEG1)C peptide was from Genscript (≥ 95% purity). Water was purified using a Millipore Milli-Q Synthesis purifier (18.0 MΩ cm ...
-
bioRxiv - Bioengineering 2019Quote: ... Cell adhesive peptides (GRGDSPC, or scrambled GRDGSPC; >95% purity; GenScript) were dissolved in PBS containing 10 mM HEPES ...
-
bioRxiv - Biophysics 2020Quote: N-terminally formylated PSM peptides (> 95% purity) were purchased from GenScript Biotech ...
-
bioRxiv - Immunology 2022Quote: All peptides were synthesized at >95% purity by GenScript (Jiangsu, China), and verified using mass spectroscopy ...
-
bioRxiv - Developmental Biology 2019Quote: ... C-terminally amidated and purified to a purity of >□95% (GenScript, USA), and their antimicrobial activity was estimated in a Minimum Inhibitory Concentration (MIC ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The fluorescent NOXA and BID peptides (95+% purity) were synthesized by GenScript and were N-terminally labeled with 5-FAM-Ahx and C-terminally modified by amidation ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 µM DrkBiT peptide (VSGWALFKKIS, synthesized by GenScript at >95% purity) was then prepared and added to wells in triplicate on four white 96-well plates (Greiner Bio-One) ...
-
bioRxiv - Microbiology 2022Quote: ... which was chemically synthesized and lyophilized as a fluoride salt (Genscript, 95% purity), was solubilized at 5 mg/ml in sterile deionized water for MIC assays or 100 mM NaCl ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SLIGRL-NH2 (> 95% purity by HPLC/MS) was purchased from Genscript (Piscataway, NJ) or EZBiolabs (Carmel ...
-
bioRxiv - Immunology 2019Quote: ... NY-ESO-1 (157-165; SLLMWITQV) peptide was purchased at >95% purity (GenScript). Purified peptide-HLA-A*02 was biotinylated in vitro by BirA enzyme (Avidity ...
-
bioRxiv - Immunology 2023Quote: The following peptides were chemically synthesized to 95% purity by GenScript (Piscataway, NJ). The peptide R9-SOCS3-KIR ...
-
bioRxiv - Immunology 2020Quote: ... Minimal epitopes used in in vitro proliferation assays were ordered from Genscript (≥ 95% pure).
-
bioRxiv - Immunology 2023Quote: ... The HCoV-OC43 nsp12/nsp13 peptides were synthesized at greater than 95% purity (GenScript).
-
bioRxiv - Genetics 2023Quote: ... The Klf2 genomic fragment from intron 2 to the exon 3 untranslated region was synthesized (GenScript) and cloned into the HindIII-SbfI site of pPGKneo-F2F-Klf2-5HR located at the opposite side of the NotI site with respect to the neo cassette ...
-
bioRxiv - Immunology 2023Quote: ... 96-well plates were coated with 2 μg/mL of recombinant Karp type-specific antigen 56 (TSA56, generated by Genscript) in PBS and blocked with 1% BSA ...
-
bioRxiv - Neuroscience 2021Quote: ... melanogaster Crz (pQTFQYSRGWTN-NH2) was custom synthesized at >95% purity by Genscript (Piscataway, NJ, USA); a non-amidated adipokinetic hormone/corazonin-related peptide (naACP ...
-
bioRxiv - Cancer Biology 2022Quote: ... SLIGRL-NH2 (PAR2) and AYPGKF-NH2 (PAR4) (≥95% purity by HPLC) were synthesized by GenScript. PAR1 selective antagonist vorapaxar was purchased from Adooq Bioscience ...
-
bioRxiv - Immunology 2022Quote: ... Both crude (∼50% purity) and purified (>95% purity; TFA removed) peptides were synthesized by GenScript USA ...
-
bioRxiv - Biochemistry 2024Quote: ... had the following sequence: KIHPSYCGPAILRFRQLLAEQEPE and was purchased by Genscript (purity >95%, checked by HPLC). The lyophilized peptide was resuspended in pure bi-distilled water at a concentration of ∼700 µM according to manufacturer instructions and stored at -80°C until use.
-
bioRxiv - Cell Biology 2022Quote: ... ferritin L (Ft-L) made by using purified human ferritin L subunit as antigen by GenScript (Nanjing, China).
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Biophysics 2024Quote: Macroscopic potassium currents (whole-cell currents) were recorded 2-3 days after injection of hKir2.1 cDNA (Genscript) using a two-electrode voltage-clamp amplifier (OC-725C ...
-
bioRxiv - Immunology 2022Quote: ... and then 30-fold molar excess of Cy7-labeled CBP ([Cy7]LRELHLNNNC[COOH], Genscript, >95% purity) was added and reacted for 30 min at room temperature for conjugation to the thiol moiety on the C residue ...
-
bioRxiv - Cell Biology 2022Quote: ... P-factor (TYADFLRAYQSWNTFVNPDRPNL) and α-factor (WHWLQLKPGQPMY) (Custom Peptide Synthesis, 4 mg, ≥95% purity, GenScript Biotech) were dissolved in DMSO to a concentration of 10 mM ...
-
bioRxiv - Microbiology 2019Quote: Pure peptides (≥95% purity) were synthesized on resin using solid phase Fmoc peptide chemistry39 by GenScript Inc ...
-
bioRxiv - Immunology 2020Quote: ... at 95°C for 5 min and then separated using ExpressPlus PAGE Gels 4-20% (GenScript). Proteins were transferred to a polyvinylidene fluoride (PVDF ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Immunology 2023Quote: ... DNA encoding HLA-C*05:01 (1-278) and β2M (1-99) were synthesized and cloned into pET30a by Genscript and were previously described42 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated protein L (GenScript) and the addition of streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Biochemistry 2021Quote: All peptides (see all sequences in Supplementary Tables 1) were purchased at 95% purity (Genscript, Leiden, Netherlands). NAD was purchased from Roche (Basel ...
-
bioRxiv - Biophysics 2023Quote: ... NTS1 peptide encompassing the first 16 residues of its CTD (SANFRQVFLSTLACLC) purchased from from GenScript (>= 95% purity) was dissolved in 100% trifluoroethanol (TFE ...
-
bioRxiv - Biochemistry 2024Quote: Subunit specific fluorogenic substrates were custom synthesized and purified by HPLC to >95% by GenScript (New Jersey). Substrates contained either an N-terminal acetylation group and a C-terminal amc group ...
-
bioRxiv - Molecular Biology 2019Quote: ... Readthrough product of rab6 (Figure 1e) was detected using rabbit anti-Rab6 3’UTR antibody (2 μg/ml, GenScript) and revealed with Clean-Blot IP Detection Reagent (Thermo Scientific ...
-
bioRxiv - Neuroscience 2019Quote: ... Samples were heated to 95°C for 5 min and resolved on 8-16% Bis-Tris gels (Genscript) before being transferred to PVDF membranes using the Iblot2 Dry blotting system (ThermoFishcer) ...
-
bioRxiv - Microbiology 2020Quote: ... The BH3-motif peptides used were commercially synthesized and were purified to a final purity of 95% (GenScript) and based on the human sequences previously described [26] except for Bok BH3 ...
-
bioRxiv - Microbiology 2020Quote: ... The BH3-motif peptides used were commercially synthesized and were purified to a final purity of 95% (GenScript) and based on the human sequences as previously described [57].
-
bioRxiv - Cancer Biology 2023Quote: ... biotinylated Protein L (GenScript USA) (25) ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Biophysics 2021Quote: Peptides corresponding to individual E1A or E2F2 binding motifs were synthesized by FMoc chemistry at >95% purity (GenScript, USA) and quantified by Absorbance at 280 nm or by quantitation of peptide bonds at 220 nm in HCl -when Tryptophan or Tyrosine residues were absent ...
-
bioRxiv - Biochemistry 2023Quote: ... Then the samples were boiled at 95°C for 15 min and run on 4-20% polyacrylamide gels (GenScript).