Labshake search
Citations for GenScript :
151 - 200 of 317 citations for IL 1RL2 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: The cloning service of recombinant human HK1b and HK1c isoforms was performed by GenScript Inc (Piscataway ...
-
bioRxiv - Biochemistry 2021Quote: ... codon optimized human DHFR was produced as a 6His-SUMO1 fusion from pET28a (Genscript).
-
bioRxiv - Immunology 2021Quote: ... Media supplemented with 10 ng/mL of recombinant human VEGF (GenScript, Piscataway, NJ, U.S.) was used as a positive control ...
-
bioRxiv - Biochemistry 2022Quote: ... the DNA coding for the human LRRK1 residues 20 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCGCTGTGTGTCCAGAACGTGCCATGG and the reverse primer TATCCACCTTTACTGTCACCTTCTCTTGCGAGTGCAAGCCTCC ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Biophysics 2022Quote: The full length human PARP1 cDNA cloned in pET28-a(+) was purchased from GenScript, USA ...
-
bioRxiv - Biochemistry 2022Quote: A codon-optimized open reading frame for Human DSS1 (DSS1) was synthesized (GenScript Inc.) with a SUMO protease cleavable N-terminal MVKIH-Strep-6x-HIS-SUMO tag ...
-
bioRxiv - Immunology 2022Quote: ... the four genes for each multispecific antibody were synthesized using human preferred codons (GenScript) and cloned into eukaryotic expression vectors ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with the recombinant plasmid carrying the human TDP1 gene (GenScript, OHU22350D) using PEI transfection reagent as previously described (Popovic et al. ...
-
bioRxiv - Neuroscience 2023Quote: Custom human TauB and TauE plasmids were created on a pET29b backbone by GenScript on a fee-for-service basis ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length human LRRC4B (OHu30422) and PTPRF (OHu02063) plasmid DNAs were purchased from GenScript.
-
bioRxiv - Biophysics 2023Quote: The γ1 ORF (human ortholog LRRC26) used in this study was obtained from Genscript database and tagged on the C-terminus with 3C protease ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Biochemistry 2023Quote: Human Mint1 open reading frame and mutant Mint1(D269A/I270A) were obtained from Genscript and cloned into the pcDNA3.1-N-eGFP ...
-
bioRxiv - Neuroscience 2020Quote: ... In white clear bottom 96-well plates 10 μL IL-34 antibody (mouse monoclonal IgG2A (v1.1 manufactured by Genscript, Ma et al., 2012), rat monoclonal IgG2A (MAB5195 ...
-
bioRxiv - Immunology 2022Quote: Both Ixodes IRE1α and TRAF2 were codon optimized for expression in human cell lines (GenScript). Primers listed in Supplemental Table 1 were used to amplify full length I ...
-
bioRxiv - Molecular Biology 2020Quote: ... Codon-optimized nucleotide sequences encoding orthologues of human SM-N100 were previously obtained from GenScript [7] ...
-
bioRxiv - Molecular Biology 2019Quote: ... The human ELK4 gene coding sequence was ligated into pIRES2 vector (GenScript, Piscataway, NJ, USA) to construct the ELK4 overexpression plasmid ...
-
bioRxiv - Biochemistry 2019Quote: ... Synthetic human non-biotinylated HEG1 7-mer peptide (residues 1375–1381) was purchased from GenScript. His6-EGFP-KRIT1(WT ...
-
bioRxiv - Immunology 2021Quote: ... a 3.5kb fragment of the human CLEC7A promoter region (chr12:10129421-10132905) was synthesized (GenScript) and cloned into the secreted Nano-Glo luciferase vector pNL1.3 (Promega) ...
-
bioRxiv - Microbiology 2020Quote: Human codon-optimized cDNA encoding SARS-CoV-2 S glycoprotein (NC_045512) was synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Biophysics 2022Quote: The mRBD (331-532) codon optimised for human cell expression was synthesized by GenScript (USA) (35) ...
-
bioRxiv - Developmental Biology 2020Quote: Dual-tagged Slit2 was designed using the human Slit2 sequence (NM_001289135.2) and ordered from Genscript Biotech ...
-
bioRxiv - Cell Biology 2022Quote: ... Human HSPE1-GFP was cloned into pcDNA3.1 from the HSPE1 (NM_002157.2) ORF Clone (OHu17870D, Genscript). The HSPE1-GFP constructs were transfected into cells using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli optimized coding sequence for human FMRP (isoform 1) was designed and synthesized by Genscript, and then subcloned into pET His6 MBP TEV LIC cloning vector (1M) ...
-
bioRxiv - Molecular Biology 2022Quote: We purchased the full-length human LRRK1 gene from Genscript (residues 1-2015, uniprot Q38SD2), codon optimized for Homo sapiens ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Human C-type natriuretic peptide (CNP) and rat atrial natriuretic peptide (ANP) were from GenScript Corp ...
-
bioRxiv - Biochemistry 2023Quote: A pcDNA 3.1 plasmid containing the full length human cytoglobin gene was purchased from GenScript. The empty vector control and specific point mutations of this plasmid were also generated by GenScript ...
-
bioRxiv - Microbiology 2023Quote: ... Human and hamster ACE2 (Q9BYF1.2 and GQ262794.1, respectively) were synthesized and cloned into pcDNA3.1+ (GenScript). All DNA constructs were verified by Sanger sequencing (ACGT) ...
-
bioRxiv - Biochemistry 2020Quote: ... Human codon-optimized HSPH1 fused C-terminally to a Myc-tag was expressed from pcDNA3.1 (Genscript). cDNA encoding wild-type human ubiquitin containing an N-terminal HA-tag was expressed from pRK5-HA (Addgene) ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding human codon-optimized spike genes with the desired mutations were purchased (GenScript, Piscataway, NJ). Supernatants containing pseudoviruses were collected 48 h post-transfection ...
-
bioRxiv - Cell Biology 2021Quote: Synaptopodin A was synthesized by Genscript using the coding sequence of human synaptopodin (NCBI Reference Sequence: NP_009217.3) and was subcloned by Genscript into HINDIII and Xho1 sites of the blasticidin-selectable mammalian expression vector pcDNA6 myc-HisA (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... and non-human private were determined by the virus surrogate neutralization kit (cat # L00847, Genscript, Singapore). The percent of neutralizing virus in sera were determinded according to the manufacturer’s protocol
-
bioRxiv - Biophysics 2020Quote: The Rh-PDE (full) gene (NCBI Gene ID: 16078606) was synthesized after human codon optimization (GenScript), as described previously13 ...
-
bioRxiv - Biochemistry 2021Quote: Codon optimized constructs of the truncated versions of human Syx were designed and obtained from GenScript. Fusion constructs were generated as described previously(48 ...
-
bioRxiv - Cell Biology 2022Quote: Three subunits of the human mTORC1 complex (mTOR, Raptor, mLST8) were codon-optimized and synthesized (GenScript). The mTOR gene was cloned into a pCAG vector without a tag ...
-
bioRxiv - Immunology 2022Quote: ... The cells were cultured for 24 hours prior to being treated with: Human IL11 (UniProtKB:P20809, GenScript), human TGFβ1 (PHP143B ...
-
bioRxiv - Immunology 2022Quote: Antibody heavy and light chain genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (pCMV3-CH ...
-
bioRxiv - Molecular Biology 2022Quote: The α2 portion of the human α2δ1 protein (NCBI reference sequence NP_00713.2) was produced by GenScript Protein Expression and Purification Services (GenScript Corp ...
-
bioRxiv - Genetics 2023Quote: The expression vector for C-terminally Flag-tagged full-length human GDF15 was obtained from Genscript. The C211G mutant was generated by site-directed mutagenesis of the wild-type vector using the QuikChange II protocol (Agilent) ...
-
bioRxiv - Neuroscience 2023Quote: ... The construct consisting of human APP770 cDNA in the pcDNA3.1 backbone was custom made (GenScript, Piscataway) and then sequenced ...
-
bioRxiv - Microbiology 2024Quote: ... The murine-human chimeric heavy and light chain sequences were then cloned into pGenDONR by GenScript, with a P2A sequence added between the heavy and light chain sequences to create the pGenDONR-IgG H1-P2A-Ig(λ ...
-
bioRxiv - Neuroscience 2024Quote: ... and a plasmid encoding human Kv5.1 with a C-terminal GFP tag was generated by Genscript. The Kv5.1BBS construct was generated at Genscript by inserting a bungarotoxin-binding site (GGWRYYESSLLPYPDGG ...
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Neuroscience 2024Quote: ... 2000) was codon optimized for human cells and synthesized into a pcDNA 3.1(+) vector by Genscript. Codon-optimized G5A and Gqi5/9 sequences as well as cloning primers and further details are provided in Supplementary file 7.
-
bioRxiv - Microbiology 2023Quote: ... Dabie Bandavirus (DBV) glycoprotein Gn gene (GenBank NC_018138.1) was codon-optimized for human codon usage (Genscript) and cloned into the expression vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... Polyreactivity was quantified by detecting bound IgG using an HRP-conjugated anti-human IgG secondary antibody (Genscript) and SuperSignal ELISA Femto Maxiumum Sensitivity Substrate (Thermo Scientific) ...
-
bioRxiv - Bioengineering 2021Quote: Recombinant human GILT-R37A-GAA protein was produced in HD Chinese hamster ovary cells and purified (Genscript). Cell culture supernatant was centrifuged ...
-
bioRxiv - Biochemistry 2020Quote: ... DNA polynucleotides encoding the BCCR opsin domains optimized for human codon usage were synthesized (GenScript, Piscataway, NJ) and cloned into the mammalian expression vector pcDNA3.1 (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...