Labshake search
Citations for GenScript :
51 - 100 of 573 citations for Hyaluronidase PH 20 SPAM1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was collected pre-cleared with 20 µl Protein A/G MagBeads (GenScript) per 1.5 ml lysate for 30 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... The pre-cast gradient gels (4-20 %) were purchased from GenScript (Piscataway, NJ). Electrophoresis was performed using a Bio-Rad SDS-PAGE gel analysis casting system (Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2024Quote: ... The reaction mixture was resolved on a 4-20% Bis-Tris gel (Genscript) and visualized by Coomassie staining.
-
bioRxiv - Genomics 2021Quote: ... H2A.X and H2A.Z antibodies are affinity-purified rabbit polyclonal antibodies made by GenScript USA Inc (Piscataway ...
-
bioRxiv - Biophysics 2021Quote: ... The samples were then loaded onto a SurePAGE gel (4-20% Bis-Tris)(Genscript). Substrate protein bands were detected by Coomassie Blue staining.
-
bioRxiv - Biochemistry 2020Quote: ... The reaction mixture was directly loaded on the 4-20% SDS-PAGE gel (GenScript) following addition of 4× laemmli loading buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... the DNA coding for the human LRRK1 residues 20 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCGCTGTGTGTCCAGAACGTGCCATGG and the reverse primer TATCCACCTTTACTGTCACCTTCTCTTGCGAGTGCAAGCCTCC ...
-
bioRxiv - Plant Biology 2022Quote: Proteins were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and 4%-20% Precast Protein Plus Gel (Yeasen ...
-
bioRxiv - Cell Biology 2023Quote: Western blots were performed using ExpressPlus PAGE Gel 4-12% or 4-20% (GenScript). Proteins were transferred to PVDF membranes (MERCK-Millipore ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were visualized by SDS-PAGE (4-20% gradient gel, Sure Page Gels, GenScript), and band intensity was determined using Image Lab (Bio-Rad) ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the 1.0x co-cultures were assessed with supplementation of 20 µM ɑ-factor (GenScript). Yeast was pre-cultivated in 0.5 mL SC (24 hrs. ...
-
bioRxiv - Cell Biology 2024Quote: ... the reaction products were loaded onto 4∼20% SDS-PAGE gels (GenScript Biotech, China), and then the signals were obtained by western blotting.
-
bioRxiv - Microbiology 2022Quote: ... The following primary antibodies were used at 1:5000 dilution: anti-FLAG antibody (GenScript), and anti-GAPDH antibody (Proteintech) ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-pT25 OsMKK1 antibody (GenScript), anti-ACT1 antibody (Beijing Protein Innovation) ...
-
bioRxiv - Microbiology 2019Quote: ... Anti-FLAG antibody (GenScript #A00187) was incubated in 10% FBS and 1xPBS for 1 h at 37°C at a concentration of 1μg/mL ...
-
bioRxiv - Microbiology 2022Quote: ... antibodies for α-Cis1a (GenScript) and α-Cis2 (GenScript ...
-
bioRxiv - Cell Biology 2023Quote: ... A rabbit polyclonal antibody (Genscript) produced against full-length Drosophila p23 (Q9VH95 ...
-
bioRxiv - Cell Biology 2024Quote: Antibodies were produced by GenScript USA (Piscataway ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Anti-streptag purified antibody (Genscript) was also APC conjugated ...
-
bioRxiv - Cell Biology 2024Quote: Antibodies were produced by GenScript USA (Piscataway ...
-
bioRxiv - Immunology 2019Quote: ... the alginate was dissolved in MES (150 mM MES, 250 mM NaCl, pH 6.5) and covalently conjugated to RGD peptide (GGGGRGDY; GenScript USA Inc., Piscataway, NJ) using carbodiimide chemistry (NHS/EDC) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The midguts were then incubated with primary antibody for liberibacter with anti-OmpB-antibody (GenScript), followed by secondary antibody conjugated with Cy3/Cy5 (Jackson ImmunoResearch Laboratories) ...
-
bioRxiv - Microbiology 2023Quote: ... was used to amplify signals from anti-FimH polyclonal antibody (custom antibody produced by Genscript). Slides were counterstained using 10 mg/mL bisBenzimide H 33258 dissolved in TBS for 20 minutes in the dark at room temperature then cover slipped ...
-
bioRxiv - Immunology 2023Quote: Neutralizing antibodies were assessed using the cPass SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript) according to manufacturer’s instructions with the following changes ...
-
bioRxiv - Biophysics 2019Quote: ... The PDZ system uses 20-50 µM of “elution peptide” (NH2-WETWV-COOH from GenScript). After the second column ...
-
bioRxiv - Plant Biology 2022Quote: ... samples were run on a 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and stained with Fast Silver Stain Kit (Beyotime ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of protein lysates were loaded onto SurePAGE Bis-Tris 4-20% gels (Genscript) and transferred either to
-
bioRxiv - Immunology 2022Quote: ... The samples were then run on the Bolt 4–20% Bis-Tris Plus Gel (GenScript) and western blot was performed ...
-
bioRxiv - Plant Biology 2023Quote: Protein samples were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) or 10% SDS-PAGE gels and electrophoresed at 150 V for 2 h ...
-
bioRxiv - Genomics 2023Quote: Cell lysates from HMLE shLuc and shM2 were separated by 4-20% SDS-PAGE (Genscript) and transferred to a PVDF membrane (10600023 GE) ...
-
bioRxiv - Immunology 2023Quote: ... A standard curve was generated using a serial dilution of the standard (GenScript, A02087-20) with a dilution factor of 1:2 ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Physiology 2019Quote: ... The primary antibody was prepared using a custom affinity-purified rabbit polyclonal antibody (Genscript, Piscataway, NJ) produced against Rhodnius prolixus RhoprCAPA-2 (EGGFISFPRV-NH2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Flag antibody was purchased from GenScript. PPP2CA (I3482-I-AP) ...
-
bioRxiv - Microbiology 2022Quote: Antibody genes were synthesized by Genscript and recombinantly produced in a human IgG backbone ...
-
bioRxiv - Microbiology 2021Quote: ... Purified antibody was produced by Genscript as human IgG in HD 293F mammalian cells ...
-
bioRxiv - Microbiology 2021Quote: ... or CaTpk2 rabbit polyclonal antibody (GenScript), at 1:1,000 dilution in 5% nonfat dry milk in TBS-T buffer plus 0.5% sodium azide for 2 hours at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... DUXBL (1:500, custom antibody, GenScript), HDAC1 (1:100 ...
-
bioRxiv - Microbiology 2022Quote: ... while the TAP antibody (Genscript, Inc) and the HA monoclonal antibody 2-2.2.14 (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... This antibody was generated by GenScript, and is derived from the same peptide sequence used to elicit “3148” from the Nelson’s lab (46) ...
-
bioRxiv - Microbiology 2023Quote: ... An unconjugated Anti-HIS antibody (Genscript) was added (5.0 mg/mL ...
-
bioRxiv - Immunology 2023Quote: ... THETM DYKDDDDK tag antibody (A00188; Genscript) and Direct-BlotTM HRP anti-mCherry antibody (clone 8C5.5 ...
-
bioRxiv - Cell Biology 2020Quote: Proteins were separated by SDS-PAGE on 4%-20% MOPS-acrylamide gels (GenScript Express Plus, M42012) and electrophoretically transferred onto Immobilon PVDF membranes (Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... and loaded in each well of a 4-20% SurePAGE™ Bis-Tris gel (M00656, GenScript). Proteins were separated by SDS-PAGE and transferred to a nitrocellulose membrane (1620145 ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-Rab6 Q72L or GST-Rab6 T27N was incubated with 20 µl Glutathione resin (L00206 GenScript) at 4°C overnight ...
-
bioRxiv - Biochemistry 2021Quote: ... A 30-mer oligoribonucleotide template and a 20-mer oligoribonucleotide primer were chemically synthesized by GenScript. The template and primer oligoribonucleotides were annealed by heating the solution to 95 °C and gradually cooling to 4 °C ...
-
bioRxiv - Immunology 2020Quote: ... at 95°C for 5 min and then separated using ExpressPlus PAGE Gels 4-20% (GenScript). Proteins were transferred to a polyvinylidene fluoride (PVDF ...
-
bioRxiv - Developmental Biology 2023Quote: Immunoblot was performed according to a standard procedure using 4%-20% gradient SDS polyacrylamide gels (Genscript). Cells were directly lysed in 4X Laemmli gel loading buffer (Boston BioProducts) ...
-
bioRxiv - Genetics 2023Quote: Proteins were separated by SDS-PAGE on 4%-20% MOPS-acrylamide gels (GenScript Express Plus, M42012) and electrophoretically transferred onto PVDF membranes ...