Labshake search
Citations for GenScript :
251 - 300 of 866 citations for Human Mesoderm Specific Transcript Homolog Protein MEST ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 Spike RBD protein (GenScript #Z03479) was immobilized on high-absorbency 96-well plates at 5 ng/mL and incubated at 4°C overnight ...
-
bioRxiv - Immunology 2023Quote: ... Protein A/G beads (Genscript, Nanjing, Jiangsu, China) were subsequently added to the mixtures and incubated for another 5 h ...
-
bioRxiv - Biochemistry 2023Quote: ... before incubation with Protein A Resin (Genscript, China) at room temperature for 2 h for antibody affinity purification ...
-
bioRxiv - Biochemistry 2024Quote: Plasmids for protein expression were ordered from Genscript (gene synthesis ...
-
bioRxiv - Immunology 2021Quote: ... Antigens included recombinant SARS-CoV−2 RBD protein obtained from the Saphire laboratory at LJI or recombinant nucleocapsid protein (GenScript Z03488). The next day ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to measure total protein content to enable equal loading of protein onto 4-12% precast mini polyacrylamide gels (SurePAGE™, GenScript). Proteins were transferred onto polyvinyl difluoride (PVDF ...
-
bioRxiv - Molecular Biology 2019Quote: The human AQP7 gene (Uniprot ID O14520) was codon-optimized and synthesized from GenScript, China ...
-
bioRxiv - Biochemistry 2020Quote: The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC ...
-
bioRxiv - Cancer Biology 2022Quote: The cloning service of recombinant human HK1b and HK1c isoforms was performed by GenScript Inc (Piscataway ...
-
bioRxiv - Biochemistry 2021Quote: ... codon optimized human DHFR was produced as a 6His-SUMO1 fusion from pET28a (Genscript).
-
bioRxiv - Immunology 2021Quote: ... Media supplemented with 10 ng/mL of recombinant human VEGF (GenScript, Piscataway, NJ, U.S.) was used as a positive control ...
-
bioRxiv - Immunology 2020Quote: ... human recombinant IL-2 (10 U/well) and with or without SIINFEKL peptide (Genscript) at 0.2ug/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... the DNA coding for the human LRRK1 residues 20 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCGCTGTGTGTCCAGAACGTGCCATGG and the reverse primer TATCCACCTTTACTGTCACCTTCTCTTGCGAGTGCAAGCCTCC ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Biophysics 2022Quote: The full length human PARP1 cDNA cloned in pET28-a(+) was purchased from GenScript, USA ...
-
bioRxiv - Biochemistry 2022Quote: A codon-optimized open reading frame for Human DSS1 (DSS1) was synthesized (GenScript Inc.) with a SUMO protease cleavable N-terminal MVKIH-Strep-6x-HIS-SUMO tag ...
-
bioRxiv - Immunology 2022Quote: ... the four genes for each multispecific antibody were synthesized using human preferred codons (GenScript) and cloned into eukaryotic expression vectors ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with the recombinant plasmid carrying the human TDP1 gene (GenScript, OHU22350D) using PEI transfection reagent as previously described (Popovic et al. ...
-
bioRxiv - Neuroscience 2023Quote: Custom human TauB and TauE plasmids were created on a pET29b backbone by GenScript on a fee-for-service basis ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length human LRRC4B (OHu30422) and PTPRF (OHu02063) plasmid DNAs were purchased from GenScript.
-
bioRxiv - Biophysics 2023Quote: The γ1 ORF (human ortholog LRRC26) used in this study was obtained from Genscript database and tagged on the C-terminus with 3C protease ...
-
bioRxiv - Biochemistry 2023Quote: Human Mint1 open reading frame and mutant Mint1(D269A/I270A) were obtained from Genscript and cloned into the pcDNA3.1-N-eGFP ...
-
bioRxiv - Immunology 2021Quote: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA ...
-
bioRxiv - Immunology 2021Quote: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA ...
-
bioRxiv - Molecular Biology 2023Quote: ... A custom RHINO polyclonal antibody was outsourced from GenScript using the recombinant protein described in the “Protein purification section” with 6xHIS tag retained and produced in rabbit (GenScript; 1:1000 dilution). The secondary antibodies were mouse IgG HRP-linked (NA931 ...
-
bioRxiv - Immunology 2019Quote: ... the cells were stained with Biotin-Protein L (Genscript) followed by fluorescently-conjugated streptavidin.
-
bioRxiv - Cell Biology 2021Quote: ... Cas9 protein was purchased from Genscript (Cat. No. Z03389). Cas9 protein (12 µg ...
-
bioRxiv - Immunology 2022Quote: Plasmids encoding cDNAs of Pneumovirus proteins were synthesized (GenScript) and cloned into the pcDNA3.1+ vector (30 ...
-
bioRxiv - Immunology 2022Quote: ... and protein G resin (L00209) were purchased from GenScript. Anti-NLRP3 (AG-20B-0014-C100 ...
-
bioRxiv - Bioengineering 2021Quote: RBD protein expressed with AviTag was purchased from GenScript. Site-specific biotinylation of the AviTag was performed using BirA Biotin-Protein Ligase Reaction kit (Avidity) ...
-
bioRxiv - Bioengineering 2021Quote: RBD protein expressed with AviTag was purchased from GenScript. Site-specific biotinylation of the AviTag was performed using BirA Biotin-Protein Ligase Reaction kit (Avidity) ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-fusion proteins were purified on glutathione resins (Genscript) as previously described (Arora ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant murine GM-CSF protein was purchased from GenScript. Therapeutic anti-CTLA4 (clone 9H10 and 9D9 ...
-
bioRxiv - Molecular Biology 2022Quote: ... was produced by GenScript Protein Expression and Purification Services (GenScript Corp, Piscataway, NJ). Briefly ...
-
bioRxiv - Synthetic Biology 2023Quote: Synthetic genes encoding designed proteins were purchased from Genscript or Integrated DNA technologies (IDT ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were separated on ExpressPlus™ PAGE gels (GenScript) and transferred to PVDF membrane (MERCK-Millipore) ...
-
bioRxiv - Cell Biology 2023Quote: ... The recombinant Hsc70-4 protein was produced by GenScript by expression of the recombinant protein with a 6X His tag in E ...
-
bioRxiv - Cancer Biology 2023Quote: ... proteins were eluted with competitive DYKDDDDK peptide (Genscript, RP10586).
-
bioRxiv - Biochemistry 2023Quote: ... The protein expression and purification were done commercially (Genscript)
-
bioRxiv - Microbiology 2024Quote: ... or recombinant RpoS protein followed by affinity purification (GenScript). Immunoblot analyses using B ...
-
bioRxiv - Immunology 2022Quote: Both Ixodes IRE1α and TRAF2 were codon optimized for expression in human cell lines (GenScript). Primers listed in Supplemental Table 1 were used to amplify full length I ...
-
bioRxiv - Molecular Biology 2020Quote: ... Codon-optimized nucleotide sequences encoding orthologues of human SM-N100 were previously obtained from GenScript [7] ...
-
bioRxiv - Molecular Biology 2019Quote: ... The human ELK4 gene coding sequence was ligated into pIRES2 vector (GenScript, Piscataway, NJ, USA) to construct the ELK4 overexpression plasmid ...
-
bioRxiv - Biochemistry 2019Quote: ... Synthetic human non-biotinylated HEG1 7-mer peptide (residues 1375–1381) was purchased from GenScript. His6-EGFP-KRIT1(WT ...
-
bioRxiv - Immunology 2021Quote: ... a 3.5kb fragment of the human CLEC7A promoter region (chr12:10129421-10132905) was synthesized (GenScript) and cloned into the secreted Nano-Glo luciferase vector pNL1.3 (Promega) ...
-
bioRxiv - Microbiology 2020Quote: Human codon-optimized cDNA encoding SARS-CoV-2 S glycoprotein (NC_045512) was synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Biophysics 2022Quote: The mRBD (331-532) codon optimised for human cell expression was synthesized by GenScript (USA) (35) ...
-
bioRxiv - Developmental Biology 2020Quote: Dual-tagged Slit2 was designed using the human Slit2 sequence (NM_001289135.2) and ordered from Genscript Biotech ...
-
bioRxiv - Cell Biology 2022Quote: ... Human HSPE1-GFP was cloned into pcDNA3.1 from the HSPE1 (NM_002157.2) ORF Clone (OHu17870D, Genscript). The HSPE1-GFP constructs were transfected into cells using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli optimized coding sequence for human FMRP (isoform 1) was designed and synthesized by Genscript, and then subcloned into pET His6 MBP TEV LIC cloning vector (1M) ...