Labshake search
Citations for GenScript :
251 - 300 of 1183 citations for Human Immunodeficiency Virus Reverse Transcriptase Protein HIV 1 Clade B IIIB since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... PAGE-MASTER Protein Standard Plus (GenScript) was used for the identification of target proteins.
-
bioRxiv - Microbiology 2021Quote: ... T1027I) and the B.1.526 lineage (L5F, T95I, D253G, E484K, D614G, A701V) were codon-optimized and synthesized by Genscript. The plasmids encoding the Spike from the B.1.617.1 (E154K ...
-
bioRxiv - Immunology 2021Quote: ... The SARS-CoV-2 S ectodomain with the 2P mutations and B.1.351 spike mutations (D80A, D215G, 242-244del, R246I, K417N, E484K, N501Y, D614G, and A701V) was synthesised by GenScript into pCMV with a C-terminal foldon and avi tag followed by an octa-histidine tag.
-
bioRxiv - Developmental Biology 2023Quote: ... or b) mRNA of either mCherry or GFP at 400ng/µl and ribonucleoprotein formed by Cas13a (GenScript, Piscataway, NJ) at 400 ng/µl and the corresponding targeting sgRNA at 400 ng/µl ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rosetta synaptobrevin a codon-optimised nucleotide sequence encoding the soluble portion of the protein [Syb (1-75)] was prepared by gene synthesis (Genscript, USA): GAGGCGAACCGTACCGGTGACTACCGTCTGCAGGAAGCGCAGCGTCAAGTGGGCGAAGTT CAAAACGTGATGCGTGATAACCTGACCAAGGTTATCGAGCGTGGTGAAAAACTGGACGATC TGGACGCGAAGGCGGAAGATCTGGAGGCGGAGGGTCAGCGTTTCCAAAACCGTGCGGGCC GTCTGCGTCGTCAGATGTGGTGGCAAAACAAACGTAACCAGTAA
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Cell Biology 2020Quote: ... and for generation of EGFP-C2-Arp3B plasmid, the mRNA transcript variant 1 encoding murine actin-related protein 3B (Actr3b) (Jay et al., 2000) was synthesized (GenScript Biotech) and cloned into pEGFP-C2 vector (Clontech).
-
bioRxiv - Immunology 2024Quote: ... Heat 500 μl of mouse serumat 56℃ and then incubated the heated serum with 1 ml of washed Protein-G resin (GenScript L00209) overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: Biotinylated SARS-CoV-2 S1 protein and biotinylated SARS-CoV-2 N protein were purchased from GenScript. The biotinylated proteins were combined with different streptavidin (SA ...
-
bioRxiv - Biochemistry 2023Quote: ... or proteins were transferred to PVDF membranes using an eBlot L1 protein transfer system (GenScript, Piscataway, NJ) and used for immunoblotting.
-
bioRxiv - Microbiology 2023Quote: ... The soluble protein fraction of cells expressing GST-tagged proteins was incubated with glutathione resin (GenScript; L00206) at 4°C for 1 h with constant rotation (10 rpm) ...
-
bioRxiv - Microbiology 2023Quote: ... cell-based expression system and RBD proteins were purified using Protein A affinity resin (Genscript Cat#: L00210). Protein purities were assessed by SDS-PAGE ...
-
bioRxiv - Cancer Biology 2023Quote: Input and IP protein samples were separated on a 4-12% Bis-Tris protein gel (GenScript, M41215C) using Tris-MOPS running buffer and then transferred onto a PVDF membrane and blocked overnight in 3% BSA in PBST buffer (PBS + 0.1% Tween 20) ...
-
bioRxiv - Immunology 2019Quote: Human lipo-IFNα1 (152-189) peptide was synthesized by GenScript (Piscataway, N.J.). Lipo refers to conjugation with the lipid moiety ...
-
bioRxiv - Biophysics 2019Quote: Human/mouse codon-optimized sequences encoding MerMAIDs were synthesized (GenScript, Piscataway, NJ) and cloned into the p-mCherry-C1 vector using NheI and AgeI restriction sites (FastDigest ...
-
bioRxiv - Cell Biology 2022Quote: ... human CSPβ fused to His6 in pET28a was from GenScript (NJ, USA), full-length human NSF fused to His6 in pET28 was a kind gift from Dr ...
-
bioRxiv - Cell Biology 2022Quote: ... Human CSPβ fused to His6 in pET28a was from GenScript (NJ, USA). The rabbit polyclonal anti-CSP antibody (affinity-purified with the immunogen directed towards the amino acids 182-198 of rat CSP) ...
-
bioRxiv - Immunology 2022Quote: Residues 18-615 of human ACE2 (UniProtKB - Q9BYF1) were synthesized by Genscript and cloned into pINFUSE-mIgG2b-Fc2 expression plasmid (InvivoGen) ...
-
bioRxiv - Cell Biology 2022Quote: ... Codon-optimized cDNAs for human SLC1A2 and SLC1A3 were obtained from Genscript and cloned in pTO vector with or without a N-terminal Strep-HA tag.
-
bioRxiv - Cell Biology 2022Quote: ... The human FLAG-tagged EMC3 plasmid was purchased from GenScript (catalog #: OHu03021D). The human FLAG-tagged EMC5 plasmid (catalog # ...
-
bioRxiv - Microbiology 2020Quote: ... The human ACE2 (residue 19-615, GenBank: NM_021804.2) was synthesized by Genscript and cloned into VRC8400 with a N-terminal Kozak consensus sequence and signal peptide and with a C-terminal octa-histidine tag.
-
bioRxiv - Biochemistry 2021Quote: ... variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... the full-length cDNA of human McIdas was obtained by GenScript (OHu00715) and cloned with an N-terminal GFP tag into the EcoRI/XhoI restriction sites of the pENTR1AminusCmR vector ...
-
bioRxiv - Microbiology 2020Quote: ... variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
bioRxiv - Biochemistry 2020Quote: ... Human pre-pro-OCN cDNA cloned into pcDNA3 was purchased from GenScript. Each construct was used as PCR template for amplification and to introduce EcoRI and AgeI cloning sites and cloned in pIRES2-EGFP-V5 plasmid ...
-
bioRxiv - Neuroscience 2021Quote: ... Site-directed mutagenesis to create human KCNH2 variants was completed by Genscript Biotech (Piscataway ...
-
bioRxiv - Immunology 2020Quote: The cDNA of the human CR3022 Fab fragment was synthesized by GenScript based on its previously reported sequence (31) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Human NRP1 (HNPR1) cloned into pCS2+ was purchased from GenScript (Piscataway, NJ). All expression constructs were confirmed by sequencing and Western blot analysis (see below) ...
-
bioRxiv - Molecular Biology 2022Quote: The cDNA encoding wildtype human MRP4 was obtained from GenScript (CloneID: OHu17173) and cloned into a donor plasmid based on the pHTBV1.1 vector73 to generate a construct featuring full-length MRP4 with a C-terminal HRV 3C-cleavable mVenus-tag linked in tandem to a Twin-Strep-tag and a 6xHis-tag ...
-
bioRxiv - Biophysics 2022Quote: ... Human TRPV4 constructs in a pcDNA3.1 vector were commercially obtained from GenScript. Expression plasmids encoding for the isolated intrinsically disordered region (IDR) ...
-
bioRxiv - Cell Biology 2023Quote: ... human NAP1 cDNA was synthesized and cloned in a pcDNA3.1 vector (Genscript), from where it was subcloned into a pGEX-4T1 vector with an N-terminal GST tag followed by a TEV cleavage site (RRID:Addgene_208870) ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding human HA-ASC and NLRP3-GFP were obtained from GenScript. Flag-NLRP3 or NLRP3-GFP Cys to Ser (CS ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Developmental Biology 2021Quote: ... The shRNA sequences were cloned into the RCAS vector (Supplementary Fig. 2A,B) by homologous recombination using a CloneEZ kit (GenScript) as previously described (Kwiatkowski et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Selected small proteins and small protein derived peptides from high-and medium observed abundance were chemically synthesized (Genscript) and subjected to LC-MS/MS as above ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fusion protein MBP-Hyx 1-176 was purified and injected into guinea pigs and the antibodies generated were purified by GenScript (Hong Kong).
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was run on separate 12% SDS–polyacrylamide gel and probed using βarr antibody and HRP-coupled protein L antibody (dilution-1:2,000; GenScript; cat. No. M00098) by western blotting ...
-
bioRxiv - Microbiology 2020Quote: ... and purified with protein A resin (GenScript) and by Ni-NTA resin (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... and biotinylated Protein A mixture (GenScript #M00095) was diluted 42 fold to 240 nM in 1x PBS with 0.0025% Tween 20 ...
-
bioRxiv - Cell Biology 2020Quote: ... NeutrAvidin and biotinylated Protein A (GenScript #M00095) were mixed in a 1:1 ratio to a final concentration of 10 μM and stored at 4 °C ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag (clone HPC4, Genscript), anti-E tag (clone 10B11 ...
-
bioRxiv - Genomics 2019Quote: ... Protein was generated by GenScript (Piscataway, NJ) and purified to >80% purity ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.2 mg/mL Protein C peptide (Genscript) and 5 mM EDTA ...
-
bioRxiv - Cell Biology 2021Quote: Commercial recombinant proteins: rhIL11 (UniProtKB: P20809, Genscript), rmIL11 (UniProtKB ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.2 mg/ml protein C peptide (Genscript), and 30 µM ‘8090.
-
bioRxiv - Biochemistry 2022Quote: ... 0.2 mg/ml protein C peptide (Genscript), and 30 µM ‘8090 ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein A Sepharose (GenScript Biotech, Piscataway USA) was used to precipitate complexes by adding a 50% slurry and incubating for further 2 h ...
-
bioRxiv - Immunology 2021Quote: Purified SARS-CoV-2 S1 protein (GenScript) in carbonate buffer ...
-
bioRxiv - Immunology 2020Quote: ... Biotin-Protein L was purchased from GenScript. BsiWI was purchased from New England Biolabs ...
-
bioRxiv - Immunology 2021Quote: Untagged SARS-CoV-2 spike protein (GenScript) containing the S1/S2 boundary furin site was coated onto the high protein binding ...