Labshake search
Citations for GenScript :
1 - 50 of 510 citations for Human Dual Specificity Phosphatase 3 DUSP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... the commercialized ELISA kit (Genscript, Cat#L00871) was used ...
-
bioRxiv - Developmental Biology 2020Quote: Dual-tagged Slit2 was designed using the human Slit2 sequence (NM_001289135.2) and ordered from Genscript Biotech ...
-
bioRxiv - Cancer Biology 2021Quote: ... The guide RNAs were cloned into the enhanced specificity CRISPR/Cas9 plasmid (eSpCas9-LentiCRISPR, v2, Genscript) (26) ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Immunology 2021Quote: Competitive inhibition ELISA was performed using SARS-CoV-2 neutralization antibody detection kit (Genscript). The kit detects circulating neutralizing antibodies against SARS-CoV-2 that block the interaction between the receptor binding domains of the viral spike glycoprotein (RBD ...
-
bioRxiv - Microbiology 2020Quote: Dual-luciferase plasmids were obtained from Genscript which used a CMV promoter to express and mRNA with the renilla luciferase gene ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The His-tagged GMCSF peptide was quantified using a His Tag ELISA Detection Kit (GenScript) according to the provided protocol and 5-10 fold dilutions of frozen samples.
-
bioRxiv - Biochemistry 2020Quote: ... immunized animal sera were tested by indirect ELISA and competitive ELISA for immune response by GenScript. Western Blot evaluation of pre-sera and sera after 3rd immunization against 200 ng of purified protein/lane using a 1:1000 dilution was performed in-house as described ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Cancer Biology 2022Quote: ... the cfDNA was modified and amplified to prepare the multiplexed paired-end sequencing libraries with the dual index using GenTrack Library Preparation Kit (GenScript). The sequencing libraries were prepared by end-repair ...
-
bioRxiv - Biochemistry 2024Quote: ... and cloned into pFastBac1 or pFastbac Dual vectors by Genscript. Second generation baculoviruses (P1 ...
-
bioRxiv - Biochemistry 2022Quote: ... GY were synthesized and cloned into dual fluorescence stall reporter (GenScript). For knockout cell pools ...
-
bioRxiv - Bioengineering 2023Quote: ... mAb was preferred for ELISA (GenScript, Cat.#A01854). For western blotting ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Cell Biology 2019Quote: IL-6 concentrations in the cell supernatant were were detected utilizing mouse IL -6 ELISA kit t (A015171517) purchased from GenScript Biological Technology Co.Ltd ...
-
bioRxiv - Synthetic Biology 2023Quote: The expression levels of his-tagged nanobodies resulting from microfermentations were quantified using the His tag ELISA detection kit (GenScript, Cat# L00436) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and non-human private were determined by the virus surrogate neutralization kit (cat # L00847, Genscript, Singapore). The percent of neutralizing virus in sera were determinded according to the manufacturer’s protocol
-
bioRxiv - Immunology 2021Quote: ... preliminary ELISA screening and production of hybridomas were performed by Genscript as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... and tested for affinity with ELISA and Western blot by Genscript.
-
bioRxiv - Biochemistry 2021Quote: ... Human EPCR cDNA (Genscript) was PCR amplified and cloned in frame with a GP64 signal peptide in a pAcGP67A transfer vector ...
-
bioRxiv - Biochemistry 2021Quote: The cDNAs encoding for human ASGR1 and human ASGR2 were obtained from GenScript (NJ). Human ASGR1 and its mutants (Q240A/W244A and Q240A/W244A/E253A ...
-
bioRxiv - Cell Biology 2024Quote: pcDNA3.1 vectors expressing human caspase-4 and human IL-18 were purchased from Genscript. Mutagenesis primers were designed using Aligent Quik change primer design ...
-
bioRxiv - Biochemistry 2024Quote: The full-length cDNAs for human SIDT1 and human SIDT2 were synthesized by Genscript Company (SIDT1 ...
-
bioRxiv - Cancer Biology 2023Quote: MSH2-MSH6: Human MSH2 and human MSH6-GFP were synthesized into pFASTBac1 constructs (GenScript) and were co-infected into Sf9 insect cells for expression ...
-
bioRxiv - Immunology 2020Quote: Recombinant human ACE2-Fc (Genscript) at concentration of 2 μg/ml in phosphate buffer saline (PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... human IL11 (hIL11, Z03108, Genscript), mouse IL11 (mIL11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... human AMPKγ3 (GenScript, NJ, USA) and mouse AMPKγ3 (Yenzym ...
-
bioRxiv - Cell Biology 2019Quote: ... Phospho-peptides conjugated to biotin for ELISA assay were synthesized by GenScript (Hong Kong). Antibodies against the IR β-subunit (sc-57342 ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Cell Biology 2023Quote: The pcDNA3.1-NR2A (catalog #: OHu24642D, NM_000833, human) and the pcDNA3.1-NR1 (catalog #: OHu22255D, NM_007327, human) plasmids were purchased from GenScript. The pcDNA3.1-BiP plasmid was provided by Dr ...
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Cell Biology 2021Quote: Codon optimized human SHIP164 generated by Genscript was amplified using PCR from the pUC57 plasmid and ligated into various mammalian and bacterial expression plasmids ...
-
bioRxiv - Genomics 2021Quote: ... human Hek293 DNA was purchased from Genscript. S ...
-
bioRxiv - Neuroscience 2022Quote: Human Stathmin expression clones were from Genscript (STMN1-OHu14092D ...
-
bioRxiv - Biophysics 2022Quote: Isoform 1 of human SERINC2 (GenScript-OHu23082D) was cloned into pFastBacI with the TEV and STREP cleavage and affinity tags upstream of the gene encoding hSERINC2 ...
-
bioRxiv - Biochemistry 2023Quote: Full-length human BAP1 and the deubiquitinase adaptor domain (DEUBAD) of ASXL1 (amino acids 237-390) were cloned into a pFastBac Dual vector by GenScript. ASXL1 was subcloned into pET24a vector for E ...
-
bioRxiv - Cell Biology 2023Quote: ... we purchased gene-synthesized codon-optimized GST-TEV-TBK1 and GST-TEV-EGFP-TBK1 in a pFastBac-Dual vector from Genscript (RRID:Addgene_208875 and Addgene_187830 ...
-
bioRxiv - Cell Biology 2023Quote: ... we purchased gene-synthesized codon-optimized GST-TEV-SINTBAD-EGFP and GST-TEV-SINTBAD-mCherry in a pFastBac-Dual vector from Genscript (RRID:Addgene_198035 and RRID:Addgene_208874) ...
-
bioRxiv - Biochemistry 2022Quote: ... The ORF2 and ORF1 constructs were cloned into the pFastBac Dual plasmid which was used to generate baculoviruses (Genscript and Medigen). To express the ORF1 proteins ...
-
bioRxiv - Developmental Biology 2022Quote: ... residues A27-T157), human FZD7 CRD (UniProt: O75084, residues Q33-G170), human FZD8 CRD (UniProt: Q9H461, residues A28-T158) were synthesized (Genscript). Human LRP6 P1E1P2E2 (UniProt ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Immunology 2019Quote: 96-well ELISA plates were coated overnight at 4°C with mouse anti-Avi-tag antibody (Genscript) at 2 μg/ml in PBS ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-human IgG peroxidase conjugated (A00166, GenScript, USA) or anti-mouse IgG peroxidase conjugated (A4416 ...
-
bioRxiv - Cancer Biology 2022Quote: ... murine and human CD20 cDNA expression constructs (GenScript) were transiently transfected into 293T cells using lipofectamine (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2022Quote: The H3F3A and H3F3B human cDNA sequences (GenScript) were cloned by using ClaI and EcoRI restriction enzymes into the pSNAPm plasmid (New England Biolabs) ...
-
bioRxiv - Biophysics 2022Quote: The human PEAK3 gene was synthesized by GenScript and subcloned into the pcDNA4/TO vector with a C-terminal 3xFLAG tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human SENP1 cDNA (ENST00000448372.5) was synthesised by GenScript to contain an N terminal FLAG tag and synonymous siRNA resistance mutations to the exon 6 and 12 siRNA used (see table 1) ...
-
bioRxiv - Biophysics 2022Quote: The gene that encodes human SERINC3 (Genscript-OHu02717D) was inserted upstream of a thrombin protease cleavable linker (LVPRGS ...