Labshake search
Citations for GenScript :
301 - 350 of 1050 citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... nucleotides 1–468) and C-terminal (VC; nucleotides 469–724) fragments of the Venus I152L variant 54 were synthetized by GenScript (Piscataway, NJ, USA). In all cases a CAT codon coding for an extra Histidine residue was added to the sequences after the first ATG start codon in order to generate NsiI restriction sites (ATGCAT ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were then incubated overnight at 4 °C in PBST with polyclonal rabbit antibodies raised against mcrA (1:10000 dilution) (GenScript, Piscataway, NJ, USA), washed four times for five minutes in PBST ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by denaturing at 70 °C for 10 min and the resulting denatured 20 µL samples were loaded onto 12% Bis-Tris PAGE gel (GenScript; Piscataway, NJ, USA). 0.5 µg of purified recombinant ApoC1 (#CSB-EP001930Hue1 ...
-
bioRxiv - Cell Biology 2023Quote: ... The membrane sections were then incubated overnight at 4°C with the corresponding antibody: anti-ChmA (dilution = 1:500; custom GenScript polyclonal rabbit antibody), HRP-conjugated mouse anti-RpoB (dilution = 1:5,000 ...
-
bioRxiv - Biophysics 2024Quote: ... Rattus norvegicus GluN1 (4a isoform) and GluN3A containing a C-terminal DYKDDDDK and within the MCS of pcDNA3.1 were purchased from Genscript (ORa13617 and ORa44363, respectively). The Trichoplax adhaerens AKDF19383 sequence was established by additional genome annotation of the Genbank TRIADDRAFT_19383 sequence (described in Fig ...
-
bioRxiv - Biochemistry 2021Quote: ... Human EPCR cDNA (Genscript) was PCR amplified and cloned in frame with a GP64 signal peptide in a pAcGP67A transfer vector ...
-
bioRxiv - Microbiology 2023Quote: We optimized the codon of SARS-CoV-2 spike (S) proteins for improved expression in human cells using GenSmart™ Codon Optimization Tool (GenScript, https://www.genscript.com), and obtained the S gene fragment of Wuhan-Hu-1 strain (GenBank ...
-
bioRxiv - Biophysics 2021Quote: Peptides corresponding to individual E1A or E2F2 binding motifs were synthesized by FMoc chemistry at >95% purity (GenScript, USA) and quantified by Absorbance at 280 nm or by quantitation of peptide bonds at 220 nm in HCl -when Tryptophan or Tyrosine residues were absent ...
-
bioRxiv - Molecular Biology 2023Quote: ... acidic coil motif (AQCEKELQALEKENAQLEWELQALEKELAQ) and Strep-Tag II (WSHPQFEK*) inserted into a pcDNA3.1-Hygro(-)-like backbone was synthesized commercially (GenScript). The R177G/R178G ...
-
bioRxiv - Biochemistry 2023Quote: ... the expression levels of each mutant series and their wild-type version were normalized for comparison purposes by quantitation via western blots against the 6xHis tags present at the C-termini of all constructs (Antibody: anti-His-Tag Antibody coupled with iFlour 488, Genscript, A01800, 1:500 dilution). Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Immunology 2022Quote: ... KIR2DL3 stable HEK293F cell lines were established to evaluate the molecules recognizing the KIR receptors using pcDNA3.1 vectors (OHu24667C, OHu17046C, OHu55562C) (GenScript). The live cells were stained for NK and CD8+ T cell surface markers (anti-CD3 ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant fraction was then incubated with 5 μg of the indicated antibodies and protein A-agarose beads (GenScript L00210) at 4°C on a nutator for 5 h ...
-
bioRxiv - Biochemistry 2021Quote: The cDNAs encoding for human ASGR1 and human ASGR2 were obtained from GenScript (NJ). Human ASGR1 and its mutants (Q240A/W244A and Q240A/W244A/E253A ...
-
bioRxiv - Cell Biology 2024Quote: pcDNA3.1 vectors expressing human caspase-4 and human IL-18 were purchased from Genscript. Mutagenesis primers were designed using Aligent Quik change primer design ...
-
bioRxiv - Biochemistry 2024Quote: The full-length cDNAs for human SIDT1 and human SIDT2 were synthesized by Genscript Company (SIDT1 ...
-
bioRxiv - Cancer Biology 2023Quote: MSH2-MSH6: Human MSH2 and human MSH6-GFP were synthesized into pFASTBac1 constructs (GenScript) and were co-infected into Sf9 insect cells for expression ...
-
bioRxiv - Immunology 2020Quote: Recombinant human ACE2-Fc (Genscript) at concentration of 2 μg/ml in phosphate buffer saline (PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... human IL11 (hIL11, Z03108, Genscript), mouse IL11 (mIL11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... human AMPKγ3 (GenScript, NJ, USA) and mouse AMPKγ3 (Yenzym ...
-
bioRxiv - Immunology 2020Quote: ... and the S1-Receptor Binding Domain (S1-RBD; Cat. No Z03483; expressed in HEK293 cells) were purchased from by GenScript. The S1-N-terminal domain (S1-NTD ...
-
bioRxiv - Microbiology 2023Quote: Genes encoding His-tagged ectodomain versions of the HSV-1 gD receptors HVEM (HVEM200t) or nectin-1 (nectin345t) were synthesized by GenScript (GenBank accession numbers AF060231 and U70321 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were transiently transfected with plasmids containing receptors of interest under eukaryotic expression promoters (ASGR1 was clone OHU03658D from GenScript), then split into 96-well plates (20,000 cells per well ...
-
bioRxiv - Cell Biology 2024Quote: ... Receptor was detected by primary rabbit anti-SNAP antibody (50 μL/well of 1:2000 dilution, GenScript, 1 h at RT) and anti-rabbit HRP antibody (50 μL/well of a 1:1000 dilution ...
-
bioRxiv - Biochemistry 2023Quote: The BoNT/X-NTNH/X complex was recombinantly co-expressed from a pET-22b vector encoding His6-tagged R360A/Y363F inactive mutant of BoNT/X and from a pET-28a(+) vector encoding NTNH/X (GenScript). The expression was performed in E ...
-
bioRxiv - Cell Biology 2023Quote: The pcDNA3.1-NR2A (catalog #: OHu24642D, NM_000833, human) and the pcDNA3.1-NR1 (catalog #: OHu22255D, NM_007327, human) plasmids were purchased from GenScript. The pcDNA3.1-BiP plasmid was provided by Dr ...
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of pseudovirus infection of cells containing SARS-CoV-2 receptors was performed on serum specimens using two commercially available SARS-CoV-2 LVV-PsN Kit (SC2087A; SC2087L; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: Codon optimized human SHIP164 generated by Genscript was amplified using PCR from the pUC57 plasmid and ligated into various mammalian and bacterial expression plasmids ...
-
bioRxiv - Genomics 2021Quote: ... human Hek293 DNA was purchased from Genscript. S ...
-
bioRxiv - Neuroscience 2022Quote: Human Stathmin expression clones were from Genscript (STMN1-OHu14092D ...
-
bioRxiv - Biophysics 2022Quote: Isoform 1 of human SERINC2 (GenScript-OHu23082D) was cloned into pFastBacI with the TEV and STREP cleavage and affinity tags upstream of the gene encoding hSERINC2 ...
-
bioRxiv - Immunology 2021Quote: ... One million cells per well were added to a U-bottom 96-well plate and were stimulated with 5 μg/ml of pools of overlapping SARS-CoV-2 S protein peptides (GenScript USA Inc, Piscataway, NJ). The stimulation was performed by incubation for 6 h at 37°C and 5% CO2 in the presence of Protein Transport Inhibitor Cocktail (brefeldin A ...
-
bioRxiv - Developmental Biology 2022Quote: ... residues A27-T157), human FZD7 CRD (UniProt: O75084, residues Q33-G170), human FZD8 CRD (UniProt: Q9H461, residues A28-T158) were synthesized (Genscript). Human LRP6 P1E1P2E2 (UniProt ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-human IgG peroxidase conjugated (A00166, GenScript, USA) or anti-mouse IgG peroxidase conjugated (A4416 ...
-
bioRxiv - Cancer Biology 2022Quote: ... murine and human CD20 cDNA expression constructs (GenScript) were transiently transfected into 293T cells using lipofectamine (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2022Quote: The H3F3A and H3F3B human cDNA sequences (GenScript) were cloned by using ClaI and EcoRI restriction enzymes into the pSNAPm plasmid (New England Biolabs) ...
-
bioRxiv - Biophysics 2022Quote: The human PEAK3 gene was synthesized by GenScript and subcloned into the pcDNA4/TO vector with a C-terminal 3xFLAG tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human SENP1 cDNA (ENST00000448372.5) was synthesised by GenScript to contain an N terminal FLAG tag and synonymous siRNA resistance mutations to the exon 6 and 12 siRNA used (see table 1) ...
-
bioRxiv - Biophysics 2022Quote: The gene that encodes human SERINC3 (Genscript-OHu02717D) was inserted upstream of a thrombin protease cleavable linker (LVPRGS ...
-
bioRxiv - Cell Biology 2023Quote: ... human NAP1 cDNA was gene-synthesized (by Genscript) and subcloned into a pGEX-4T1 vector with an N-terminal MBP-tag followed by a TEV cleavage site before wild-type NAP1 (RRID:Addgene_208871) ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
Analysis of spike protein variants evolved in a novel mouse model of persistent SARS-CoV-2 infectionbioRxiv - Microbiology 2023Quote: Recombinant SARS-CoV-2 wild-type S protein RBD-HRP fusion protein (RBD-HRP protein, cat. no. Z03594) and hACE2 protein (cat. no. Z03516) were purchased from GenScript Korea Ltd ...
-
bioRxiv - Microbiology 2021Quote: ... and protein purification was performed with Protein A magnetic beads (GenScript, L00695). The purified mAbs were dialyzed against phosphate-buffered saline (PBS ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated protein L (GenScript) and the addition of streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Microbiology 2019Quote: ... coli protein production (Genscript) and used as templates for subsequent cloning ...
-
bioRxiv - Cell Biology 2020Quote: ... The human BMI1 sequence (pUC57 vector, GenScript, Leiden, NL) was inserted upstream of the hTERT sequence by enzymatic digestion (XbaI and MluI ...
-
bioRxiv - Microbiology 2019Quote: ... The human TRIM34 cDNA was purchased from Genscript (NM_001003827.1). Human TRIM34 was cloned into pHIV/dTomato using NotI and XmaI sites with an HA tag encoded at the N-terminus ...
-
bioRxiv - Cell Biology 2020Quote: ... TM27 and human IRE1α-TM were synthesized by Genscript. Genes corresponding to the transmembrane peptides with following amino acid sequences ...