Labshake search
Citations for GenScript :
301 - 350 of 583 citations for Human CLEC4M L SIGN His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: The plasmid harboring wild-type Tsa1 (pET19b-Tsa1) was originally obtained with an amino-terminal deca-histidine-tag in a codon-optimized manner from GenScript (kind gift from P.O ...
-
bioRxiv - Immunology 2023Quote: Genes coding for SARS-CoV-2 Spike (S) ectodomains (Hu-1 and BA.1) with Hisx8 and Strep tags were synthesized by Genscript and cloned into the pcDNA3.1(+ ...
-
bioRxiv - Microbiology 2023Quote: ... A recodonized version of full-length PfPK2 with at AvrII and StuI sites upstream of a loxP sequence in frame with GFP tag was custom synthesized as a G-block (Genscript). The resulting plasmid DNA construct (pSLI-PfPK2-loxP ...
-
bioRxiv - Immunology 2023Quote: Full length Erdr1 (Erdr1-177) and Erdr1 deficiency C-terminal 32 amino acid (Erdr1-145) with C-terminal HA tags was synthesized (GenScript) and cloned into pcDNA3.1 plasmid using In-Fusion cloning (Clontech) ...
-
bioRxiv - Biochemistry 2023Quote: The open reading sequences encoding TcdB1-GTD to TcdB8-GTD were synthesized with a C-terminal His6 tag and cloned into pET28a(+) by Genscript. Sequence length and strain information is shown in Supplementary Table 1 ...
-
bioRxiv - Biochemistry 2023Quote: Wildtype and mutant PRD-0038 S constructs consisting of residues 1-1235 and containing a 21 residue C-terminal deletion (del21) followed by a 3x FLAG tag were synthesized by GenScript and placed into an HDM plasmid ...
-
bioRxiv - Biochemistry 2023Quote: The recombinant PLpro wild type and mutants’ genes with an N-terminal Hisx6 tag was introduced into the pET-28b (+) bacterial expression vector by GenScript, Inc ...
-
bioRxiv - Cell Biology 2024Quote: ... and eluted from the column by incubation with either reduced glutathione (to retain the GST tag) or with 10 units Prescission Protease (Genscript) to obtain protein without a tag ...
-
bioRxiv - Biochemistry 2024Quote: ... and synthesized and cloned into the pET-DUET-1 vector with a C-terminal Tobacco Etch Virus (TEV) protease cleavage site (ENLYFQG) and hexahistidine tag (His6) (GenScript). The expression construct was transfected into E ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Biochemistry 2024Quote: ... fused to consecutive C-terminal HA (hemagglutinin)- and FLAG-tags and cloned into pCDNA-3.1 plasmid for expression in HEK293 cells by the CMV (cytomegalovirus) promoter (GenScript Biotech). Mutant variants were generated by site directed mutagenesis (GenScript Biotech).
-
bioRxiv - Biophysics 2024Quote: ... or C154Y mutants optimized for expression in yeast were cloned in a pPIC9K vector upstream of a sequence coding for a PreScission protease cleavage site (LEVLFQGP) followed by a linker of 11 amino acids and a 10His tag (GenScript). The plasmids were introduced in Pichia pastoris strain SMD1163 (his4 ...
-
bioRxiv - Cell Biology 2020Quote: ... The human BMI1 sequence (pUC57 vector, GenScript, Leiden, NL) was inserted upstream of the hTERT sequence by enzymatic digestion (XbaI and MluI ...
-
bioRxiv - Microbiology 2019Quote: ... The human TRIM34 cDNA was purchased from Genscript (NM_001003827.1). Human TRIM34 was cloned into pHIV/dTomato using NotI and XmaI sites with an HA tag encoded at the N-terminus ...
-
bioRxiv - Cell Biology 2020Quote: ... TM27 and human IRE1α-TM were synthesized by Genscript. Genes corresponding to the transmembrane peptides with following amino acid sequences ...
-
bioRxiv - Biochemistry 2021Quote: ... Human anti-SP IgG standards (chimera, GenScript, Piscataway, NJ) or human ACE-2 Fc (chimera ...
-
bioRxiv - Developmental Biology 2022Quote: ... Lohse and a ORF human PTH1R (Genscript, cat.no. OHu15045D) was transfected into 293 cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... we outsourced purified recombinant human RHINO protein from GenScript. Rhno1 cDNA with N-terminal 6xHIS tag and TEV cleavage sequence was cloned into a pET30a vector and expressed in E ...
-
bioRxiv - Immunology 2023Quote: ... 50 µL of phycoerythrin (PE)-conjugated human ACE2 (Genscript) was added to each well and incubated for an additional 15 mins at 37°C with agitation ...
-
bioRxiv - Genetics 2023Quote: Genes were human codon-optimized and synthesized by Genscript, and plasmids were generated using a combination of restriction digestion ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human OTUD4 (isoform 4 NP_001352986.1) was purchased from GenScript. Human OTUD4 constructs were cloned without tag or with FLAG-tag into the expression plasmid pcDNA3.1 (Life technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... The human XIST oligo pool was ordered from GenScript and amplified as previously described to generate ssDNA biotinylated oligos (Engreitz et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Blocking buffer was removed and replaced with 20 mL blocking buffer supplemented with 4 μL anti-HIS primary antibody (mAb, mouse, GenScript®) and the blot was incubated overnight at 4°C with agitation ...
-
bioRxiv - Immunology 2023Quote: ... a biotinylated rat polyclonal antibody against human Fc was used as a capture antibody and anti-human IgG Fc-HRP (GenScript Cat# A01854-200) as a detection antibody ...
-
bioRxiv - Biochemistry 2019Quote: ... NPC2 bound to LBPA isomers was detected by incubating the Snoopers with rabbit polyclonal anti-c-myc-tag antibody (RRID: AB_914457, GenScript, Piscataway, NJ) at a concentration of 0.5μg/ml in TBS + 3% BSA for one hour at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... a GlySer-linker and the C-tag flanked by PmeI sites was amplified by PCR from a synthetic fragment provided by GenScript (USA), codon-optimized for expression in a low protease background C1 ...
-
bioRxiv - Biochemistry 2021Quote: ... The cDNAs encoding mCer-mCit sensor or CRONOS were synthesized and subcloned into pET28a vector containing His6 tag (Genscript, NJ, USA).
-
bioRxiv - Biochemistry 2021Quote: Mammalian expression plasmid pcDNA3.1+/C-(K)-DYK carrying the ORF sequence of WT CYP21A2 (NM_000500.7) with a C-terminal DYK (FLAG) tag was purchased from GenScript (New Jersey, USA). We used this plasmid as a template to create the variants through site-directed mutagenesis ...
-
bioRxiv - Biochemistry 2022Quote: ... coding sequence was synthesised and cloned into a pET28a plasmid with N-terminal His6-tev purification tag (supplied by Genscript Ltd).
-
bioRxiv - Molecular Biology 2023Quote: ... AAP13442.1) with N-terminal His6 tags were made by inserting DNA between NcoI and BamHI sites of pET15b (GenScript, Piscataway, NJ). pET15b-His6-Nsp1(SARS CoV2 ...
-
bioRxiv - Immunology 2023Quote: DNA encoding for residues 24-167 of the extracellular portion of human PD-1 (UniProt Q15116) with a C-terminus histidine tag or corresponding PD-1 N58Q mutant were cloned into pcDNA3.4 by GenScript (Piscataway, NJ). Expi293 cells were transiently transfected with plasmid DNA mixed with PEI (Polysciences ...
-
bioRxiv - Biochemistry 2022Quote: Codon-optimized gene corresponding to 5 to 897 amino acids of KFDV NS5 with an N-terminal Hexa-histidine tag was synthesized (Genscript USA) and sub-cloned into pET-28a (+ ...
-
bioRxiv - Molecular Biology 2023Quote: ... Equal amounts of GST-G12-like and His-AaCPR100A sonicated lysates were mixed with high-affinity GST resin (GenScript, Piscataway, NJ, USA), and then eluted ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were incubated with primary antibody for one hour (α-CLuc; Santa-Cruz Biotech) at room temperature or overnight at 4°C (α-His; GenScript), followed by washes with TBS-T ...
-
bioRxiv - Microbiology 2022Quote: ... and DNA was synthesized and cloned in-framed into pcDNA-based vectors containing a human IgG1 constant region and a human kappa light chain constant region (GenScript USA Inc., Piscataway, NJ).
-
bioRxiv - Microbiology 2021Quote: ... A549 cells were transduced with codon-optimized human ACE2 (Genscript) cloned into pBABE-puro [54] (Addgene) ...
-
bioRxiv - Bioengineering 2022Quote: ... Protein sequences were human codon-optimized using online tools (GenScript), synthesized as gene blocks (IDT) ...
-
bioRxiv - Molecular Biology 2022Quote: 60 Human ORF clones were purchased from GenScript (https://www.genscript.com) for the Wnt pathway (Table S1) ...
-
bioRxiv - Genetics 2019Quote: ... then 300ng/ml human recombinant BMP2 (GenScript, Wanchai, Hong Kong) was added for 48 hours ...
-
bioRxiv - Neuroscience 2021Quote: ... DYKDDDDK (Flag)-tagged human FAM57B plasmid was purchased from Genscript. Hemagglutinin (HA)-tagged human CerS plasmids were generated as described76.
-
bioRxiv - Microbiology 2020Quote: ... A human chimeric anti-S1 antibody (Genscript; 1:200 dilution) followed by an Alexa647-conjugated goat anti-human IgG (Jackson Laboratories ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the open reading frame of human GPx2 (GenScript NM_002083.4) was subcloned by PCR into Xho1/BamH1 restriction sites of lentiviral expression vector pLVX-puro (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: The human mGluR constructs (except mGluR6) were synthesized by GenScript in fragments and assembled in lab ...
-
bioRxiv - Cancer Biology 2023Quote: ... as well as human EGFR (GenScript, Piscataway, NJ; Cat# Z03194) as a control surface ...
-
bioRxiv - Cell Biology 2023Quote: Human PITPNB cDNA (OHu06208C) was purchased from GenScript (Piscataway, NJ). To construct plasmids for knockout of PITPNB and PI4KB genes ...
-
bioRxiv - Biochemistry 2023Quote: ... Human Pcdh21 isoform 1 (NCBI accession NP_149091.1) was synthesized (GenScript) and cloned into a pCDNA3.1 vector (ThermoFisher ...
-
bioRxiv - Biophysics 2019Quote: ... pET21 vectors containing the inserted sequences for CsgF fused to the plasmid-encoded C-terminal hexahistidine tag were obtained from Genscript (Piscataway, NJ). E ...
-
bioRxiv - Biochemistry 2021Quote: ... were each synthesised with a N-terminal honeybee melittin signal peptide and a C-terminal TEV protease cleavage site and His6-tag by GenScript (Hong Kong) and subcloned into the pFastBac1 vector.
-
bioRxiv - Biochemistry 2020Quote: ... fused to the Saccharomyces cerevisiae alpha factor secretion signal (N-terminal)40 followed by a C-terminal Sortase-A recognition sequence and a His6 tag (C-terminal) was synthesized and cloned into pPICZalpha by GenScript (NJ, USA) using EcoRI and SacII restriction sites to produce pPICZalphaA-RBD-Hisx6.
-
bioRxiv - Biochemistry 2020Quote: ... and followed by a C-terminal Sortase-A recognition sequence for covalent coupling39 and a His6 tag for purification (LPETGHHHHHH) was synthesized by GenScript (NJ, USA) and cloned into the pCDNA3.1(+ ...