Labshake search
Citations for GenScript :
251 - 300 of 847 citations for Glutathione S Transferase Alpha 2 GSTA2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... IP/Western blot antibodies were rabbit anti-Xenopus laevis CD2AP polyclonal affinity purified antibody raised against the peptide CRPKSEVEPHSKTKT custom made by GenScript and anti-Xenopus laevis FOLR1 antibody (GenScript). After washing steps ...
-
bioRxiv - Molecular Biology 2022Quote: Rabbit polyclonal antibodies were generated by Genscript using the following peptides where additional single Cysteine residues for the cross-linking purpose are indicated in lowercase ...
-
CRISPR-Cas9 Engineered Extracellular Vesicles for the Treatment of Dominant Progressive Hearing LossbioRxiv - Bioengineering 2023Quote: ... anti-Cas9 antibody (Genscript, Cat# A01935, USA) 1% BSA mixture overnight at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... using anti-His (mouse) primary antibody (GenScript) at a dilution of 1:3,000 ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Codon-optimized spike of SARS-CoV-2 was purchased from GenScript and subcloned to pcDNA3.1 ...
-
bioRxiv - Immunology 2021Quote: ... SARS CoV-2 Nucleocapsid human chimeric mAb (GenScript, Cat # A02039-100), or in-house antibodies to ORF3a and ORF8 served as positive controls ...
-
bioRxiv - Microbiology 2022Quote: ... An anti-SARS-2 nucleocapsid protein rabbit antiserum (generated by GenScript) was used at a 1:1000 dilution to detect specific anti–SARS-2 immunoreactivity using the Discovery ULTRA automated staining instrument (Roche Tissue Diagnostics ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein-crud (RP30020, GenScript Biotecn Corp). A ten amino acid overlapping peptide mixture pool was prepared ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 N and S1 proteins were obtained from Genscript and Sino Biological.
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 spike gene (Wuhan) was synthesized by Genscript for Dr ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 2 mL of nickel resin (GenScript) at RT for 20 minutes and washed once with lysis buffer and another three times with wash buffer (20 mM Tris-Cl pH8.8 ...
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The secondary antibody solution consisted of MonoRab ™: Rabbit Anti-Camelid VHH Antibody [HRP] mAb (GenScript, Cat. # A01861-200) (1:5000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Lysates were then incubated with antibody (anti-Myc antibody 9E10 or anti-CycB3, from rabbit, custom-made by Genscript) for 1 hour ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transferred membranes were incubated with the following primary antibodies overnight at 4°C: DUXBL (1:1000, Custom antibody, GenScript), ZSCAN4C (1:500 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The next morning the buffer was replaced with 10 ml new TBST (2.5% milk) and primary antibody added (polyclonal rabbit antibodies ordered from GenScript). The antibody used for each blot is indicated in the figure ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times with goat anti-rabbit IgG antibody or goat anti-mouse IgG antibody (GenScript) for one hour followed by washing three times with TBST again ...
-
bioRxiv - Microbiology 2019Quote: ... the dissected thrips tissues that were only incubated with secondary antibody (without adding primary antibody) and the tissues incubated with each pre-immune mouse antiserum (GenScript) were used as negative controls ...
-
bioRxiv - Immunology 2023Quote: The antibody heavy chain genes of matured AIIMS-P01 lineage antibody was synthesized after codon-optimization for mammalian expression from Genscript, Inc ...
-
bioRxiv - Neuroscience 2023Quote: ... IP/Western blot antibodies were rabbit anti-Xenopus laevis CD2AP polyclonal affinity purified antibody raised against the peptide CRPKSEVEPHSKTKT custom made by GenScript and anti-Xenopus laevis FOLR1 antibody (GenScript) ...
-
bioRxiv - Cancer Biology 2023Quote: Capture antibodies: affinity purified rabbit anti-L1 (anti-ORF1p or anti-ORF2p (RT fragment)) polyclonal antibodies were ordered from GenScript (Custom Polyclonal Antibody Production Service) ...
-
bioRxiv - Bioengineering 2024Quote: ... washed and incubated with 0.1 μM anti-HA-FITC antibody and 0.1 μM anti-FLAG-iFluor 647 antibody (GenScript, Nanjing, China) for 15 min in dark ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were blocked and incubated with primary antibodies and secondary antibodies using eZwest Lite Automated Western Device (GenScript Biotech, China). Membranes were then incubated with Omni-ECL™Femto Light Chemiluminescence Kit (Epizyme ...
-
bioRxiv - Developmental Biology 2021Quote: Polyclonal antibodies were generated by Genscript (https://www.genscript.com/). The epitopes used for each immunization are listed below.
-
bioRxiv - Developmental Biology 2021Quote: Anti-ApoB-1 antibodies were generated by GenScript USA (Piscataway ...
-
bioRxiv - Immunology 2021Quote: Generation of antibody expression vectors was outsourced (Genscript). The Ig VH and VL sequences were cloned into a pcDNA3.4 expression vector containing human IgG1 constant regions ...
-
bioRxiv - Neuroscience 2019Quote: The polyclonal DIPγ antibody was generated by Genscript in guinea pigs using the following epitope ...
-
bioRxiv - Bioengineering 2020Quote: ... HRP-conjugated secondary antibodies against His-tag (Genscript) were diluted 1:5,000-10,000 and incubated with the well for 1 hr at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Genes of bispecific antibodies were synthesized by Genscript. The authentic Omicron (B.1.1.529 ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse anti-Tubulin antibody (1:10000, A01410, GenScript), rabbit anti-LaminB1 (1:5000 ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse α-His antibody (1:1000, Genscript A00186) in TBST buffer with 0.5% BSA and goat α-mouse IgG (H+L ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... rabbit anti-p65me2 (customized antibody, Genscript, Piscataway, NJ), mouse anti-FLAG M2 (at 1:3,000 dilution ...
-
bioRxiv - Immunology 2019Quote: Recombinant antibodies were cloned and expressed by Genscript. Briefly ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... or rabbit anti-myc tag antibodies (GenScript; A00172).
-
bioRxiv - Developmental Biology 2021Quote: ... The polyclonal NvINSM1 antibody was raised by GenScript in rabbit against amino acids 3 – 170 of NvINSM1 expressed in and purified from E.coli ...
-
bioRxiv - Biochemistry 2021Quote: Polyclonal antibodies against PTP7 were generated by Genscript. Briefly ...
-
bioRxiv - Microbiology 2020Quote: Recombinant antibodies were cloned and produced by Genscript. Specifically ...
-
bioRxiv - Microbiology 2021Quote: ... neutralizing monoclonal antibody (GenScript®, clone ID: 6D11F2) was also used ...
-
bioRxiv - Immunology 2020Quote: ... or corresponding species-appropriate IgG control antibody (GenScript), conjugated to Protein A Dynabeads (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant antibody was cloned and produced by Genscript. Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... THE V5 Tag Antibody (1:2000, GenScript Biotech) was used as primary antibody for samples and mouse anti-clathrin heavy chain clone 23 (1:2,000 ...
-
bioRxiv - Plant Biology 2022Quote: ... specific rabbit His-tag antibody (GenScript, A00174-40) or anti-monoubiquityl-histone H2B (Lys-120 ...
-
bioRxiv - Biochemistry 2022Quote: ... and mouse anti-HA-tag monoclonal antibody (GenScript). After primary antibody incubation ...
-
bioRxiv - Developmental Biology 2023Quote: Polyclonal antibodies were generated by Genscript (https://www.genscript.com/). The protein sequences used for each immunization were as follows ...
-
bioRxiv - Developmental Biology 2022Quote: ... immunization and antibody purification were performed by Genscript Biotech Corporation (Piscataway ...
-
bioRxiv - Bioengineering 2023Quote: ... GenCRISPRLL SaCas9 Antibody 26H10 (GenScript, #A01952, Piscataway, NJ), and Anti-Adeno-associated Virus 9 Antibody clone HL2374 (Millipore Sigma ...