Labshake search
Citations for GenScript :
1 - 50 of 635 citations for Glutathione Reductase Fluorescent Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: Glutathione S-Transferase (GST) (GenScript; Cat. # Z02039-1), ubiquitin (R&D Systems ...
-
bioRxiv - Biochemistry 2023Quote: ... His-ERK was further purified using 1 mL glutathione resin (GenScript) to remove any residual GST-tagged MKK1.
-
bioRxiv - Biochemistry 2020Quote: Glutathione resin (GenScript, Cat. # L00206)
-
bioRxiv - Biochemistry 2021Quote: Glutathione resin (GenScript, Cat. # L00206)
-
bioRxiv - Biochemistry 2021Quote: ... Magnetic glutathione beads (L00327; GenScript Biotech) were loaded with the purified PARP7 zinc finger proteins ...
-
bioRxiv - Molecular Biology 2022Quote: ... The gene coding for γ-glutamyl phosphate reductase was ligated into the pHTP1 expression vector (GenScript Biotech, Netherlands) producing a recombinant protein which contains an N-terminal hexahistidine and Kanamycin resistance ...
-
bioRxiv - Plant Biology 2019Quote: ... coli and affinity purified using Glutathione Resin (GenScript) and TALON® Metal Affinity Resin (Clontech) ...
-
bioRxiv - Biochemistry 2021Quote: ... and 1 mM DTT and incubated with magnetic glutathione beads (L00327; GenScript Biotech, Piscataway, NJ, USA) loaded with recombinant GST-tagged AF1521 for 2 to 4 hours at 4°C with rotation ...
-
bioRxiv - Cell Biology 2021Quote: ... coli lysates using glutathione-agarose or -sepharose (Sigma; GenScript) and Talon metal affinity resin (Clontech) ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-fusion proteins were purified on glutathione resins (Genscript) as previously described (Arora ...
-
bioRxiv - Cell Biology 2021Quote: ... recombinant GST-fusion proteins immobilized on glutathione-sepharose beads (GenScript) for 3 h at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was collected and incubated for 1 h with 2 ml of 50% slurry of Glutathione Resin (Genscript) before loading onto an empty EconoPac gravity-flow column (Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2020Quote: ... Soluble protein was further purified via glutathione agarose chromatography (GenScript # L00206) with gravity flow at room temperature in fresh buffer B ...
-
bioRxiv - Cancer Biology 2022Quote: ... sBRAF kinase domain constructs were purified using glutathione affinity resin (Genscript, catalogue ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Plant Biology 2024Quote: ... coli followed by protein purification using Glutathione Resin (GenScript, Cat. No. L00206). About 80μg cleaved NFR5 was collected for analysis ...
-
bioRxiv - Immunology 2021Quote: ... GST-tagged NSUN2 proteins were purified by affinity chromatography using reduced glutathione resin (GenScript, L00206) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... and the cleaved GST and thrombin were removed with glutathione-magnetic beads (GenScript, Piscataway, NJ) and benzamidine-Sepharose beads (GE Healthcare) ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-Rab6 Q72L or GST-Rab6 T27N was incubated with 20 µl Glutathione resin (L00206 GenScript) at 4°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: M1 ubiquitinated proteins were enriched using GST-tagged UBAN-coupled Glutathione MagBeads (Genscript, Piscataway NJ, SA), as described previously 116 ...
-
bioRxiv - Microbiology 2023Quote: ... The soluble protein fraction of cells expressing GST-tagged proteins was incubated with glutathione resin (GenScript; L00206) at 4°C for 1 h with constant rotation (10 rpm) ...
-
bioRxiv - Microbiology 2021Quote: Fluorescent-tagged phage proteins were synthesized into pDSW206 by Genscript and delivered as lyophilized plasmid ...
-
bioRxiv - Plant Biology 2021Quote: ... The filtered supernatant was mixed with 2 mL slurry of previously washed and equilibrated Glutathione Sepharose 4B beads (GenScript). After incubation ...
-
bioRxiv - Biochemistry 2023Quote: ... The resulting lysate was centrifuged at 12,000 x g to separate the soluble protein fraction and incubated with glutathione resin (GenScript) for 30 minutes while shaking at room temperature (RT) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified FLAG-tagged proteins were cleaved from MBP or Glutathione S-transferase (GST) using 3C protease (Genscript #Z03092-100) and their purity was analyzed by SDS-PAGE.
-
bioRxiv - Cell Biology 2024Quote: ... and eluted from the column by incubation with either reduced glutathione (to retain the GST tag) or with 10 units Prescission Protease (Genscript) to obtain protein without a tag ...
-
bioRxiv - Biochemistry 2020Quote: Binding of the fluorescent transport substrate peptide RRY(CFluorescein)KSTEL (Genscript) to WT and mutant TmrAB was determined as a function of the change in fluorescence polarization as described in [10] ...
-
bioRxiv - Bioengineering 2019Quote: ... OmpT fluorescent peptide substrate was custom ordered from Genscript (Piscataway, NJ).
-
bioRxiv - Neuroscience 2024Quote: ... An additional plasmid encoding green fluorescent protein (GFP; pCAG-GFP; GenScript), was used to label successfully transfected cells ...
-
bioRxiv - Microbiology 2022Quote: ... 100 μL of cell lysate was saved as an input control and the remaining cell lysate was incubated with Glutathione MagBeads (GenScript, L00327) overnight at 4°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The fluorescent NOXA and BID peptides (95+% purity) were synthesized by GenScript and were N-terminally labeled with 5-FAM-Ahx and C-terminally modified by amidation ...
-
bioRxiv - Microbiology 2021Quote: Microtiter plates (96-well; Thermo) were coated with 1 μg/mL S-2P protein (Genscript) corresponding to the S protein of the Wuhan-Hu-1 virus ...
-
bioRxiv - Microbiology 2022Quote: ... fumigatus-optimized fluorescent protein mNeonGreen by using vector pSR25 (synthesized by GenScript, Piscataway, NJ). Primer pairs AtrR-CoNG MH F (CCCGGTCTTCGACACCA ATGGTCCACCCCACGGTGGATTGGCTGGTGCCGGTGCTGGT ...
-
bioRxiv - Microbiology 2024Quote: ... and synthetic fragments and genes encoding the fluorescent proteins from Genscript (Supplementary Table 2).
-
bioRxiv - Immunology 2023Quote: ... Plates were coated with 500 ng/mL RBD or 1 μg/mL NP (GenScript, Piscataway, New Jersey), and heat-inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... SCOOP10 and SCOOP12 peptides were labeled with fluorescent 5-FAM at the N-termini (GenScript, China) and the final working concentration of labelled peptides was adjusted to 0.05 μM with ddH2O ...
-
bioRxiv - Immunology 2022Quote: ... 2 × 106 splenocytes from each animal were transferred in a round bottom 96 well plate (200 µl volume) and ex vivo restimulated with 1 µg/ml of the lmon_0149 peptides YSYKFIRV (GenScript) and QVFEGLYTL (made in house by solid phase synthesis ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were plated in a 6 well plate and co-transfected with 1 μg of pUC57-NASP-FKBP12F36V (by Genscript) and 2 μg of pSpCas9(BB)-2A-Puro-NASP-sgRNA_V2.0 (#62988 ...
-
bioRxiv - Microbiology 2023Quote: ... 1 × 106 splenocytes were plated into each well of a 96-well flat-bottom plate and either left untreated or treated with 1 ug/ml p56 (AGPHNDMEI) or p79 (TSINFVKI) peptides (Genscript, Piscataway, NJ) for 5 h at 37°C in the presence of Brefeldin A (BD Cytofix/Cytoperm ...
-
bioRxiv - Cell Biology 2019Quote: ... DOPE-MPB lipids were then reacted with the terminal cysteine residue of a fluorescent CtermCldn4 peptide (300 nM, 5-FAM-Ahx-CPPRTDKPYSAKYSAARSAAASNYV, GenScript) for 1 hr at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... a library of potential substrates flanked by 5FAM fluorescent dye and DABCYL quencher (5FAM-substrate-Lys{DABCYL}-Amide) was synthesized by Genscript or manufactured in-house using Liberty Blue peptide synthesizer (CEM) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Mpro inhibition assay was performed using the FRET-based fluorescent peptide substrate DABCYL-KTSAVLQ↓SGFRKM-E(EDANS)-NH2 (purchased from Genscript). The assay was standardized with enzyme concentration of 140 nM and 30 µM of fluorescent substrate in Mpro assay buffer containing (20 mM Tris pH 7.3 ...
-
bioRxiv - Neuroscience 2023Quote: ... SnifferOT cells were transiently transfected to express the red fluorescent genetically encoded calcium indicator R-GECO (GenScript, Piscataway, NJ, USA) with Fugene HD reagent (Promega ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... with a unique 5′fluorescent reporter dye (FAM) and 3 fluorescent quencher dye (TAMRA) were designed using mouse mitochondrial genome sequences and synthesized by Genscript (Piscataway, NJ). For absolute quantification using qPCR ...
-
bioRxiv - Immunology 2021Quote: ... Plates were coated overnight with 100 ng/well of S1 (Genscript) in coating buffer (0.015M carbonate/bicarbonate buffer ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Immunology 2019Quote: 96-well plates were coated overnight at 4°C with mouse anti-Avi-tag antibody (Genscript) at 2 μg/ml in PBS ...
-
bioRxiv - Cell Biology 2020Quote: The endotoxin level of FHL-1 recombinant protein preparations was measured using the Toxin Sensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, NJ, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2019Quote: 96-well ELISA plates were coated overnight at 4°C with mouse anti-Avi-tag antibody (Genscript) at 2 μg/ml in PBS ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...