Labshake search
Citations for GenScript :
101 - 150 of 767 citations for Glutamate Decarboxylase 2 GAD2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... The mCherry WT- dynamin-2 was constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Physiology 2019Quote: ... The primary antibody was prepared using a custom affinity-purified rabbit polyclonal antibody (Genscript, Piscataway, NJ) produced against Rhodnius prolixus RhoprCAPA-2 (EGGFISFPRV-NH2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Flag antibody was purchased from GenScript. PPP2CA (I3482-I-AP) ...
-
bioRxiv - Microbiology 2022Quote: Antibody genes were synthesized by Genscript and recombinantly produced in a human IgG backbone ...
-
bioRxiv - Microbiology 2021Quote: ... Purified antibody was produced by Genscript as human IgG in HD 293F mammalian cells ...
-
bioRxiv - Microbiology 2021Quote: ... or CaTpk2 rabbit polyclonal antibody (GenScript), at 1:1,000 dilution in 5% nonfat dry milk in TBS-T buffer plus 0.5% sodium azide for 2 hours at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... DUXBL (1:500, custom antibody, GenScript), HDAC1 (1:100 ...
-
bioRxiv - Microbiology 2022Quote: ... while the TAP antibody (Genscript, Inc) and the HA monoclonal antibody 2-2.2.14 (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... This antibody was generated by GenScript, and is derived from the same peptide sequence used to elicit “3148” from the Nelson’s lab (46) ...
-
bioRxiv - Microbiology 2023Quote: ... An unconjugated Anti-HIS antibody (Genscript) was added (5.0 mg/mL ...
-
bioRxiv - Immunology 2023Quote: ... THETM DYKDDDDK tag antibody (A00188; Genscript) and Direct-BlotTM HRP anti-mCherry antibody (clone 8C5.5 ...
-
bioRxiv - Cell Biology 2022Quote: ... antibody and a custom rabbit anti-NCX1 antibody as previously described5 (1:100, Genscript Corporation, Piscataway, NJ). Secondary antibody labeling was carried out using donkey anti-mouse Alexa Fluor 647 (1:200 ...
-
bioRxiv - Microbiology 2024Quote: ... The EspE antibody (1:5,000 dilution) was a custom rabbit polyclonal antibody against the CGQQATLVSDKKEDD peptide (Genscript).
-
bioRxiv - Synthetic Biology 2022Quote: ... and 2 mL Protein A slurry (1 mL resin, GenScript) was deposited in the columns ...
-
bioRxiv - Immunology 2022Quote: ... DNA encoding SARS-CoV-2 HexaPro Spike was synthesized (Genscript) and transiently transfected in FreeStyle 293F cells (Thermo Fisher ...
-
bioRxiv - Immunology 2020Quote: ... and 0.6 μg/mL SARS-CoV-2 S-ECD (GenScript). After washes with PBST (SMART-Lifesciences) ...
-
bioRxiv - Physiology 2022Quote: ... The WT dynamin-2 mCherry plasmid were constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Immunology 2023Quote: ... plus 10 ng/mL of mouse IL-2 (Z02764, Genscript) in 2 mL complete RPMI1640 medium for 72 h.
-
bioRxiv - Evolutionary Biology 2022Quote: ... with two replicates for each antibody (LY-CoV016, LY-CoV555, REGN10987, and S309 [Genscript, Gene-to-Antibody service]) assay on different days ...
-
bioRxiv - Bioengineering 2022Quote: ... A mouse anti-His-Tag antibody (GenScript) was diluted 1:100 and used as the primary antibody ...
-
bioRxiv - Microbiology 2020Quote: Custom rabbit polyclonal antibodies (GenScript, Nanjing, China) raised against tryptic peptides of Mtb EsxN (AQAASLEAEHQAIVR ...
-
bioRxiv - Immunology 2021Quote: ... biotinylated detection antibody (GenScript, Cat# 5E10G8-Biotin) was added at 1 µg/mL final concentration in blocking buffer and plate was incubated at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... Both antibodies were recombinantly produced by Genscript. The rREGN10987 is that used in (Starr et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Both antibodies were recombinantly produced by Genscript. The rREGN10987 is that used in (25 ...
-
bioRxiv - Cell Biology 2020Quote: ... Coronin peptide antibody was generated by GenScript as peptide-KLH conjugation in New Zealand rabbits (sequence in Table 3) ...
-
bioRxiv - Microbiology 2021Quote: ... Anti-Loqs antibody (custom generated by GenScript), Anti-HA antibody (ab130275 ...
-
bioRxiv - Immunology 2020Quote: ... and the CD3/CD4 bispecific antibody (Genscript) to expand CD8 T-cells ...
-
bioRxiv - Genomics 2021Quote: ... The capturing antibody (rabbit FL Gcn5 (Genscript), rat high affinity anti HA (MilliporeSigma 11867423001) ...
-
bioRxiv - Cell Biology 2023Quote: ... immunoblotted with antibodies (anti-GFP from Genscript, anti-DYKDDDK from Genscript ...
-
bioRxiv - Neuroscience 2023Quote: ... IP/Western blot antibodies were rabbit anti-Xenopus laevis CD2AP polyclonal affinity purified antibody raised against the peptide CRPKSEVEPHSKTKT custom made by GenScript and anti-Xenopus laevis FOLR1 antibody (GenScript). After washing steps ...
-
bioRxiv - Molecular Biology 2022Quote: Rabbit polyclonal antibodies were generated by Genscript using the following peptides where additional single Cysteine residues for the cross-linking purpose are indicated in lowercase ...
-
CRISPR-Cas9 Engineered Extracellular Vesicles for the Treatment of Dominant Progressive Hearing LossbioRxiv - Bioengineering 2023Quote: ... anti-Cas9 antibody (Genscript, Cat# A01935, USA) 1% BSA mixture overnight at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... using anti-His (mouse) primary antibody (GenScript) at a dilution of 1:3,000 ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding SARS-CoV-2 and other coronavirus S-2P (Genscript) were transiently transfected in FreeStyle 293-F cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Codon-optimized spike of SARS-CoV-2 was purchased from GenScript and subcloned to pcDNA3.1 ...
-
bioRxiv - Immunology 2021Quote: ... SARS CoV-2 Nucleocapsid human chimeric mAb (GenScript, Cat # A02039-100), or in-house antibodies to ORF3a and ORF8 served as positive controls ...
-
bioRxiv - Microbiology 2022Quote: ... An anti-SARS-2 nucleocapsid protein rabbit antiserum (generated by GenScript) was used at a 1:1000 dilution to detect specific anti–SARS-2 immunoreactivity using the Discovery ULTRA automated staining instrument (Roche Tissue Diagnostics ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein-crud (RP30020, GenScript Biotecn Corp). A ten amino acid overlapping peptide mixture pool was prepared ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 N and S1 proteins were obtained from Genscript and Sino Biological.
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 spike gene (Wuhan) was synthesized by Genscript for Dr ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 2 mL of nickel resin (GenScript) at RT for 20 minutes and washed once with lysis buffer and another three times with wash buffer (20 mM Tris-Cl pH8.8 ...
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The secondary antibody solution consisted of MonoRab ™: Rabbit Anti-Camelid VHH Antibody [HRP] mAb (GenScript, Cat. # A01861-200) (1:5000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Lysates were then incubated with antibody (anti-Myc antibody 9E10 or anti-CycB3, from rabbit, custom-made by Genscript) for 1 hour ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transferred membranes were incubated with the following primary antibodies overnight at 4°C: DUXBL (1:1000, Custom antibody, GenScript), ZSCAN4C (1:500 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The next morning the buffer was replaced with 10 ml new TBST (2.5% milk) and primary antibody added (polyclonal rabbit antibodies ordered from GenScript). The antibody used for each blot is indicated in the figure ...