Labshake search
Citations for GenScript :
101 - 150 of 425 citations for FGF 8B Human Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... VSMCs were treated with either 1 ng/ml human TNFα (GenScript, Z00100) or 2.4 mM inorganic phosphate in the absence or presence of 0.1μM GSK2656157 (Cayman ...
-
bioRxiv - Biophysics 2022Quote: ... Human TRPV4 constructs in a pcDNA3.1 vector were commercially obtained from GenScript. Expression plasmids encoding for the isolated intrinsically disordered region (IDR) ...
-
bioRxiv - Cell Biology 2023Quote: ... human NAP1 cDNA was synthesized and cloned in a pcDNA3.1 vector (Genscript), from where it was subcloned into a pGEX-4T1 vector with an N-terminal GST tag followed by a TEV cleavage site (RRID:Addgene_208870) ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding human HA-ASC and NLRP3-GFP were obtained from GenScript. Flag-NLRP3 or NLRP3-GFP Cys to Ser (CS ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Microbiology 2023Quote: ... 0.6 mg/mL mouse anti-FimH (Sokurenko (mouse samples) or custom antibody produced by Genscript (bacterial samples), 0.1 mg/mL anti-GroEL (Enzo) ...
-
bioRxiv - Immunology 2019Quote: ... splenocytes from Pmel were isolated and culture with 1µM human gp100 (hgp100) (Genscript) and 30 IU/mL recombinant human IL-2 (PeproTech Inc ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... hTRPV5 E288DF292LS298T (IS-1) and human TRPV6 (hTRPV6) WT] were obtained from GenScript Corporation (Nanjing ...
-
bioRxiv - Biochemistry 2021Quote: The human Sgk3 gene was codon optimized for expression in insect cells (Genscript) and fused to the C-terminus of His10/StrepII-tagged eGFP (A206K monomeric variant ...
-
bioRxiv - Immunology 2021Quote: ... the variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
bioRxiv - Biophysics 2023Quote: ... DNA human WNK3 (118-409) was subcloned into a pET29b vector by Genscript Inc ...
-
bioRxiv - Molecular Biology 2023Quote: ... a plasmid with the human NSMCE2 cDNA was purchased from GenScript (cat # Ohu31586D). The NSMCE2 coding sequence was PCR-amplified to add a Kozak consensus sequence for efficient initiation of translation and flanking KpnI and XhoI restriction sites ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids expressing human KLF family proteins were purchased from Genscript (Piscataway, NJ) or OriGene (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: The human abhd14b gene22 was synthesized as a codon-optimized construct (from Genscript) for expression in E ...
-
bioRxiv - Cell Biology 2024Quote: ... the codon-optimized gene containing full-length human SNX27 was synthesized by GenScript® and cloned into pET28a vector as described previously (30) ...
-
bioRxiv - Cell Biology 2020Quote: We obtained mouse TMEM16K cDNA from Genscript (Clone ID ...
-
bioRxiv - Bioengineering 2022Quote: ... A mouse anti-His-Tag antibody (GenScript) was diluted 1:100 and used as the primary antibody ...
-
bioRxiv - Plant Biology 2022Quote: ... mouse anti-Flag (A00187, GenScript, Piscataway, NJ), rabbit anti-histone H3 (A01502 ...
-
bioRxiv - Biophysics 2020Quote: Mouse 5-HT3AR gene (purchased from GenScript) and mutant genes were inserted into pTLN plasmid ...
-
bioRxiv - Genetics 2023Quote: ... A plasmid containing mouse Pax1 (GenScript; OMu21524) was used as template for DIG-labeled probes ...
-
bioRxiv - Microbiology 2024Quote: ... using anti-His (mouse) primary antibody (GenScript) at a dilution of 1:3,000 ...
-
bioRxiv - Molecular Biology 2019Quote: The human AQP7 gene (Uniprot ID O14520) was codon-optimized and synthesized from GenScript, China ...
-
bioRxiv - Biochemistry 2020Quote: The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC ...
-
bioRxiv - Cancer Biology 2022Quote: The cloning service of recombinant human HK1b and HK1c isoforms was performed by GenScript Inc (Piscataway ...
-
bioRxiv - Biochemistry 2021Quote: ... codon optimized human DHFR was produced as a 6His-SUMO1 fusion from pET28a (Genscript).
-
bioRxiv - Immunology 2021Quote: ... Media supplemented with 10 ng/mL of recombinant human VEGF (GenScript, Piscataway, NJ, U.S.) was used as a positive control ...
-
bioRxiv - Immunology 2020Quote: ... human recombinant IL-2 (10 U/well) and with or without SIINFEKL peptide (Genscript) at 0.2ug/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... the DNA coding for the human LRRK1 residues 20 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCGCTGTGTGTCCAGAACGTGCCATGG and the reverse primer TATCCACCTTTACTGTCACCTTCTCTTGCGAGTGCAAGCCTCC ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Biophysics 2022Quote: The full length human PARP1 cDNA cloned in pET28-a(+) was purchased from GenScript, USA ...
-
bioRxiv - Biochemistry 2022Quote: A codon-optimized open reading frame for Human DSS1 (DSS1) was synthesized (GenScript Inc.) with a SUMO protease cleavable N-terminal MVKIH-Strep-6x-HIS-SUMO tag ...
-
bioRxiv - Immunology 2022Quote: ... the four genes for each multispecific antibody were synthesized using human preferred codons (GenScript) and cloned into eukaryotic expression vectors ...
-
bioRxiv - Neuroscience 2023Quote: Custom human TauB and TauE plasmids were created on a pET29b backbone by GenScript on a fee-for-service basis ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with the recombinant plasmid carrying the human TDP1 gene (GenScript, OHU22350D) using PEI transfection reagent as previously described (Popovic et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Biophysics 2023Quote: The γ1 ORF (human ortholog LRRC26) used in this study was obtained from Genscript database and tagged on the C-terminus with 3C protease ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length human LRRC4B (OHu30422) and PTPRF (OHu02063) plasmid DNAs were purchased from GenScript.
-
bioRxiv - Biochemistry 2023Quote: Human Mint1 open reading frame and mutant Mint1(D269A/I270A) were obtained from Genscript and cloned into the pcDNA3.1-N-eGFP ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-RHDV RdRp was prepared by Genscript and stored in our laboratory ...
-
bioRxiv - Molecular Biology 2020Quote: cDNA of mouse Tia1 was purchased from GenScript in pcDNA3.1 vectors (clone ID ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse anti-Tubulin antibody (1:10000, A01410, GenScript), rabbit anti-LaminB1 (1:5000 ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse α-His antibody (1:1000, Genscript A00186) in TBST buffer with 0.5% BSA and goat α-mouse IgG (H+L ...
-
bioRxiv - Microbiology 2019Quote: ... mouse and rabbit anti-six histidine tag (Genscript, Nanjing ...
-
bioRxiv - Genetics 2021Quote: ... We followed up with Mouse anti His6 (Genscript), rabbit anti-HA-PE (Cell Signaling Technology) ...
-
bioRxiv - Molecular Biology 2021Quote: ... mouse anti FLAG-tag (1:500; A00187, GenScript). Anti-rabbit and anti-mouse secondary antibodies coupled to Alexa-488 ...
-
bioRxiv - Biochemistry 2022Quote: ... and mouse anti-HA-tag monoclonal antibody (GenScript). After primary antibody incubation ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-Protein C (mouse, Genscript, A01774, 1:1000), anti-α-tubulin (mouse ...
-
bioRxiv - Biochemistry 2023Quote: ... Mouse PANX1 (UniprotID: Q9JIP4) was synthesized by GenScript and subcloned into the pEGC Bacmam vector(41) ...
-
bioRxiv - Immunology 2022Quote: Both Ixodes IRE1α and TRAF2 were codon optimized for expression in human cell lines (GenScript). Primers listed in Supplemental Table 1 were used to amplify full length I ...