Labshake search
Citations for GenScript :
1 - 50 of 991 citations for F actin uncapping protein LRRC16A CARMIL1 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding cDNA for hMPV 130-BV F and hMPV B2 F proteins were synthesized (GenScript) and cloned into the pcDNA3.1+ vector as previously described (29 ...
-
bioRxiv - Immunology 2020Quote: Plasmids encoding cDNAs for hMPV F proteins listed in Table S1 were synthesized (GenScript) and cloned into the pcDNA3.1+ vector ...
-
bioRxiv - Microbiology 2021Quote: ... using primary antibodies specific for MeV F HRC (rabbit polyclonal, Genscript, 503028-1) and 6xHis tag (rabbit polyclonal ...
-
bioRxiv - Microbiology 2021Quote: ... using primary antibodies specific for MeV F HRC (rabbit polyclonal, Genscript, 503028-1) and 6xHis tag (rabbit polyclonal ...
-
bioRxiv - Immunology 2022Quote: ... B2 F and hMPV B2F-GCN4 recombinant proteins were synthesized from the plasmids obtained from GenScript cloned into pcDNA3.1+ vector ...
-
bioRxiv - Immunology 2024Quote: ... and incubated with FITC conjugated anti-FLAG mouse monoclonal antibody (GenScript, Cat. No. A01632) at a concentration of 2 µg per million cells for 1 hr at 37 C in the dark ...
-
bioRxiv - Cell Biology 2024Quote: FITC-labeled aminocaproic acid-disulfide-cyclized ACRGDGWCG peptide (FITC-cyclic-ACRGDGWCG) and FITC-labeled aminocaproic acid-GRGDLGRLKK peptide (FITC-proTGFβ3 peptide) were synthesized by GenScript. Preliminary experiments (Supplementary Fig ...
-
bioRxiv - Bioengineering 2024Quote: ... washed and incubated with 0.1 μM anti-HA-FITC antibody and 0.1 μM anti-FLAG-iFluor 647 antibody (GenScript, Nanjing, China) for 15 min in dark ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Cell Biology 2021Quote: ... and Idp3 (FITC-YEDKKGMCKL, Genscript) were solubilized in water and used in the assay at a final concentration of 10 nM ...
-
bioRxiv - Immunology 2022Quote: ... β-Actin (GenScript, 1:15,000), T-bet (clone 4B10 Santa Cruz ...
-
bioRxiv - Immunology 2022Quote: ... β-actin (GenScript, 1:15,000), goat anti-mouse (Jackson Immunoresearch ...
-
bioRxiv - Cell Biology 2022Quote: ... We used the following primary antibodies diluted in TNT buffer: anti-beta actin (1:1000, GenScript), anti-Lamin B1 (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Molecular Biology 2022Quote: ... The genes for the designed HN protein variant 1 (HNv1) and F protein variant 1 (Fv1) were codon-optimized for expression in SJ and synthesized by Genscript® ...
-
bioRxiv - Immunology 2023Quote: ... the transduction rate of lentivirus on Car-T cells was analyzed by FITC-anti-VHH antibody (GenScript Inc.). Target cells were detected for NKG2D ligands using anti-MICA/MICB and anti-ULBP2/5/6 ...
-
bioRxiv - Biochemistry 2022Quote: ... anti-beta-ACTIN (GenScript A00702), anti-TOMM40 (Proteintech 18409-1-AP) ...
-
bioRxiv - Plant Biology 2023Quote: ... anti-beta Actin [HRP] (GenScript), anti-DspE50 ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were then incubated with the primary antibodies: rabbit anti-α-actin (200×, GenScript, New Jersey, USA), mouse anti-α-actin (400× ...
-
bioRxiv - Cell Biology 2021Quote: Fluorescein isothiocyanate (FITC) labeled peptides corresponding to the carboxyl-terminal 10 amino acids of Yhl045w (FITC-RKRVLGVAYL, Genscript) and Idp3 (FITC-YEDKKGMCKL ...
-
bioRxiv - Cell Biology 2020Quote: ... and for generation of EGFP-C2-Arp3B plasmid, the mRNA transcript variant 1 encoding murine actin-related protein 3B (Actr3b) (Jay et al., 2000) was synthesized (GenScript Biotech) and cloned into pEGFP-C2 vector (Clontech).
-
bioRxiv - Immunology 2024Quote: ... HMPV F (54G10 monoclonal42 generated by Genscript).
-
bioRxiv - Microbiology 2020Quote: ... mouse anti–β-actin (A00702, Genscript), or mouse anti-calnexin antibody (2433S ...
-
bioRxiv - Cancer Biology 2022Quote: ... ß-actin HRP Conjugated (GenScript; # A00730, RRID:AB_914100). Secondary Antibodies were ...
-
bioRxiv - Immunology 2023Quote: ... Antibodies were purified with Protein A magnetic beads (GenScript, L00273). Expression vectors for CoV-2196 ...
-
bioRxiv - Immunology 2024Quote: ... Antibodies were purified with Protein A magnetic beads (GenScript, L00273).
-
bioRxiv - Immunology 2024Quote: ... Antibodies were purified with Protein A magnetic beads (GenScript, L00273).
-
bioRxiv - Cell Biology 2023Quote: ... and the primers covering SNPs in the Cth (F- GAGCCTGGGAGGATATGAGA, R- AAGCTCGATCCAGGTCTTCA) and Ttc4 (F – GACAGGGCGGAACTATACCA, genes. qPCR products were Sanger sequenced using the GenScript Biotec Sanger sequencing service.
-
bioRxiv - Microbiology 2024Quote: ... yeast cells displayed with the substrate complex were labeled with iFluor 647 conjugated anti-FLAG and FITC conjugated anti-HA antibodies (GenScript, Nanjing, China). The fluorescence signals of labeled cells were quantitated with Beckman Coulter CytoFLEX Flow Cytometer (Beckman Coulter ...
-
bioRxiv - Biochemistry 2020Quote: ... Xanthoxycyclin D and xanthoxycyclin F were purchased from GenScript Inc ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified protein was used for raising polyclonal antibodies in rabbits (Genscript). Optimal detection of SAP05 in phytoplasma-infected plants occurred at a 1:2,000 dilution of the antibody ...
-
bioRxiv - Immunology 2023Quote: ... supernatants containing monoclonal antibodies were purified using Protein A magnetic beads (Genscript), and the purified samples were verified by SDS-PAGE.
-
bioRxiv - Molecular Biology 2024Quote: ... Protein G Magnetic Beads were pre-incubated with V5 antibody (A01724, Genscript) for 4 h and crosslinked with 10 volumes of crosslinking buffer containing 20 mM DMP (3 mg DMP/ml of 0.2 M Boric Acid pH 9 ...
-
bioRxiv - Cell Biology 2021Quote: ... The anti-Mps1 antibodies were generated in rabbits against a recombinant Mps1 protein fragment (residues 440-764) of the protein by Genscript. The company provided affinity purified antibodies that we validated by purifying kinetochores from yeast strains with Mps1 or Mps1-13Myc and confirming that the antibody recognized a protein of the correct molecular weight that migrated more slowly with the 13Myc epitope tags ...
-
bioRxiv - Biophysics 2023Quote: ... The anti-Scm3 antibodies were generated in rabbits against a recombinant Scm3 protein fragment (residues 1-28) of the protein by Genscript. The company provided affinity-purified antibodies that we validated by immunoprecipitating Scm3 from yeast strains with Scm3-V5 and confirming that the antibody recognized a protein of the correct molecular weight that was also recognized by α-V5 antibody (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... the FITC-labeled ubiquitin pentapeptide RLRGG (GenScript, Piscataway, NJ, USA) was added to a final working concentration of 50 nM ...
-
bioRxiv - Cell Biology 2024Quote: Protein lysates were incubated with 1 µg mouse anti-V5 antibody (Genscript A01724) for 2 h at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Twin-strep-tagged proteins were detected using HRP conjugated anti-StrepII antibody (Genscript). Acetylated Histone H4 was detected by Abcam H4 antibody cat no ab177790 ...
-
bioRxiv - Neuroscience 2022Quote: ... and Beta Actin (1:2000, A00702, GenScript, Piscataway, NJ). Membranes were then washed and probed with horseradish-peroxidase-conjugated donkey anti-mouse or anti-rabbit IgG (H+L ...
-
bioRxiv - Biophysics 2024Quote: Antibodies were obtained from the following sources: Protein C-Tag Antibody (HPC4) (Rabbit polyclonal) was from Genscript (Piscataway, NJ, USA); Anti-Phosphotyrosine Antibody ...
-
bioRxiv - Molecular Biology 2020Quote: ... The protein complexes were detected by western blot with anti-His antibody (Genscript, A00186) and anti-Flag antibody (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... GiGrx5 and GiBolA proteins were detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal GiTom40 and GiIscU were detected with a specific polyclonal antibody raised in rabbits (84) ...
-
bioRxiv - Immunology 2023Quote: ... supernatants containing the monoclonal antibodies were purified using protein A magnetic beads (Genscript, L00695). The purified samples were determined by SDS-PAGE.
-
bioRxiv - Immunology 2024Quote: ... and then supernatants containing monoclonal antibodies were purified by Protein A magnetic beads (Genscript). The purified mAb samples were verified by SDS-PAGE.
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was run on separate 12% SDS–polyacrylamide gel and probed using βarr antibody and HRP-coupled protein L antibody (dilution-1:2,000; GenScript; cat. No. M00098) by western blotting ...
-
bioRxiv - Microbiology 2021Quote: The CH0848 T/F envelope (env) sequence was chemically synthesized (GenScript, USA) and cloned into the pcDNA3.3-TOPO vector (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: Polyclonal Rabbit antibodies against the potential S-Layer protein of A_DKE were generated by GenScript Biotech B ...
-
bioRxiv - Plant Biology 2021Quote: ... Accumulation of FHT-HA protein was assayed by immunoblot with a monoclonal HA antibody (GenScript).
-
bioRxiv - Cell Biology 2020Quote: Our RAD-51 antibody was generated from a His-tagged fusion protein expressed by Genscript from plasmid pET30a containing the entire RAD-51S coding sequence (1385 bp ...
-
bioRxiv - Immunology 2021Quote: ... The lysate was immunoprecipitated using designated primary antibodies with protein G resin (GenScript, Piscataway, NJ), or anti-Flag M2 affinity agarose gel at 4°C ...