Labshake search
Citations for GenScript :
201 - 250 of 426 citations for Estrogen receptor ER alpha Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: The cDNAs encoding human or mink ACE2 were synthesized by GenScript and cloned into pLVX-IRES-zsGreen1 vectors (Catalog No ...
-
bioRxiv - Microbiology 2020Quote: ... The cDNA encoding human TMPRSS2 (NM_005656; OHu13675D) was obtained from Genscript. The cDNA fused to a C-terminal HA tag was subcloned into pQXCIH (Clontech ...
-
bioRxiv - Immunology 2021Quote: ... SARS CoV-2 Nucleocapsid human chimeric mAb (GenScript, Cat # A02039-100), or in-house antibodies to ORF3a and ORF8 served as positive controls ...
-
bioRxiv - Cell Biology 2022Quote: ... IA) and human TOM1L2 (long isoform NP_001076437 gene synthesized by Genscript) were PCR amplified and cloned in FRT vectors with mNeonGreen (NG) ...
-
bioRxiv - Microbiology 2022Quote: ... recombinant human ACE2-IgG-Fc fragments (r-hACE2-Fc) (GenScript, Z03516) were firstly incubated with the Protein-G agarose (Millipore ...
-
bioRxiv - Biophysics 2022Quote: ... The gene that encodes human SERINC5 (OHu11910D) was purchased from GenScript.
-
bioRxiv - Molecular Biology 2023Quote: A bacterial codon-optimized human MITF-M+ ORF synthesized by GenScript Biotech was cloned using Gibson assembly (New England Biolabs ...
-
bioRxiv - Biochemistry 2023Quote: ... human ARL15 (NM_019087.3) in the pcDNA3.1+/C-(K)-DYK vector (GenScript) was used and further employed to introduce the mutations into the construct ...
-
bioRxiv - Immunology 2022Quote: ... ACE2 fused to human IgG1 Fc domain was gene synthesized (Genscript) and cloned into pCEP4 ...
-
bioRxiv - Biophysics 2023Quote: ... human TRPM5 in pcDNA3.1+ (Accession No: NM_014555.3) was purchased from GenScript, and zebrafish TRPM5 in pEG BacMam was kindly provided by Seok-Yong Lee (Duke University).
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant human vascular endothelial growth factor-165 (VEGF) was from GenScript, and basic fibroblast growth factor (bFGF ...
-
DTX3L and USP28 fine-tune DNA double strand repair through mutual regulation of their protein levelsbioRxiv - Biochemistry 2023Quote: A codon optimised DNA encoding human USP28 was procured from Genscript and cloned between the NdeI/BamHI multiple cloning site (MCS ...
-
bioRxiv - Immunology 2024Quote: ... were codon-optimized for human cell expression (GenScript Codon Optimization Tool). Gene fragments were each cloned into a pαH eukaryotic expression vector with a C-terminal HRV 3C protease cleavage site ...
-
bioRxiv - Biochemistry 2023Quote: ... the expression levels of each mutant series and their wild-type version were normalized for comparison purposes by quantitation via western blots against the 6xHis tags present at the C-termini of all constructs (Antibody: anti-His-Tag Antibody coupled with iFlour 488, Genscript, A01800, 1:500 dilution). Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Molecular Biology 2020Quote: The E2-Crimson-human HSD11B1 gene (variant 1) was synthesised by GenScript in vector pUC57 ...
-
bioRxiv - Immunology 2019Quote: Human lipo-IFNα1 (152-189) peptide was synthesized by GenScript (Piscataway, N.J.). Lipo refers to conjugation with the lipid moiety ...
-
bioRxiv - Biophysics 2019Quote: Human/mouse codon-optimized sequences encoding MerMAIDs were synthesized (GenScript, Piscataway, NJ) and cloned into the p-mCherry-C1 vector using NheI and AgeI restriction sites (FastDigest ...
-
bioRxiv - Cell Biology 2022Quote: ... human CSPβ fused to His6 in pET28a was from GenScript (NJ, USA), full-length human NSF fused to His6 in pET28 was a kind gift from Dr ...
-
bioRxiv - Cell Biology 2022Quote: ... Human CSPβ fused to His6 in pET28a was from GenScript (NJ, USA). The rabbit polyclonal anti-CSP antibody (affinity-purified with the immunogen directed towards the amino acids 182-198 of rat CSP) ...
-
bioRxiv - Immunology 2022Quote: Residues 18-615 of human ACE2 (UniProtKB - Q9BYF1) were synthesized by Genscript and cloned into pINFUSE-mIgG2b-Fc2 expression plasmid (InvivoGen) ...
-
bioRxiv - Cell Biology 2022Quote: ... Codon-optimized cDNAs for human SLC1A2 and SLC1A3 were obtained from Genscript and cloned in pTO vector with or without a N-terminal Strep-HA tag.
-
bioRxiv - Cell Biology 2022Quote: ... The human FLAG-tagged EMC3 plasmid was purchased from GenScript (catalog #: OHu03021D). The human FLAG-tagged EMC5 plasmid (catalog # ...
-
bioRxiv - Microbiology 2020Quote: ... The human ACE2 (residue 19-615, GenBank: NM_021804.2) was synthesized by Genscript and cloned into VRC8400 with a N-terminal Kozak consensus sequence and signal peptide and with a C-terminal octa-histidine tag.
-
bioRxiv - Biochemistry 2021Quote: ... variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... the full-length cDNA of human McIdas was obtained by GenScript (OHu00715) and cloned with an N-terminal GFP tag into the EcoRI/XhoI restriction sites of the pENTR1AminusCmR vector ...
-
bioRxiv - Microbiology 2020Quote: ... variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
bioRxiv - Biochemistry 2020Quote: ... Human pre-pro-OCN cDNA cloned into pcDNA3 was purchased from GenScript. Each construct was used as PCR template for amplification and to introduce EcoRI and AgeI cloning sites and cloned in pIRES2-EGFP-V5 plasmid ...
-
bioRxiv - Neuroscience 2021Quote: ... Site-directed mutagenesis to create human KCNH2 variants was completed by Genscript Biotech (Piscataway ...
-
bioRxiv - Immunology 2020Quote: The cDNA of the human CR3022 Fab fragment was synthesized by GenScript based on its previously reported sequence (31) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Human NRP1 (HNPR1) cloned into pCS2+ was purchased from GenScript (Piscataway, NJ). All expression constructs were confirmed by sequencing and Western blot analysis (see below) ...
-
bioRxiv - Molecular Biology 2022Quote: The cDNA encoding wildtype human MRP4 was obtained from GenScript (CloneID: OHu17173) and cloned into a donor plasmid based on the pHTBV1.1 vector73 to generate a construct featuring full-length MRP4 with a C-terminal HRV 3C-cleavable mVenus-tag linked in tandem to a Twin-Strep-tag and a 6xHis-tag ...
-
bioRxiv - Physiology 2023Quote: ... VSMCs were treated with either 1 ng/ml human TNFα (GenScript, Z00100) or 2.4 mM inorganic phosphate in the absence or presence of 0.1μM GSK2656157 (Cayman ...
-
bioRxiv - Biophysics 2022Quote: ... Human TRPV4 constructs in a pcDNA3.1 vector were commercially obtained from GenScript. Expression plasmids encoding for the isolated intrinsically disordered region (IDR) ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding human HA-ASC and NLRP3-GFP were obtained from GenScript. Flag-NLRP3 or NLRP3-GFP Cys to Ser (CS ...
-
bioRxiv - Cell Biology 2023Quote: ... human NAP1 cDNA was synthesized and cloned in a pcDNA3.1 vector (Genscript), from where it was subcloned into a pGEX-4T1 vector with an N-terminal GST tag followed by a TEV cleavage site (RRID:Addgene_208870) ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Immunology 2019Quote: ... splenocytes from Pmel were isolated and culture with 1µM human gp100 (hgp100) (Genscript) and 30 IU/mL recombinant human IL-2 (PeproTech Inc ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... hTRPV5 E288DF292LS298T (IS-1) and human TRPV6 (hTRPV6) WT] were obtained from GenScript Corporation (Nanjing ...
-
bioRxiv - Biochemistry 2021Quote: The human Sgk3 gene was codon optimized for expression in insect cells (Genscript) and fused to the C-terminus of His10/StrepII-tagged eGFP (A206K monomeric variant ...
-
bioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP) labeled-mouse anti-human IgG-Fc specific (GenScript No. A01854) diluted 1:10,000 in PBST was added (100μl/well ...
-
bioRxiv - Immunology 2021Quote: ... the variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
bioRxiv - Biochemistry 2023Quote: The human abhd14b gene22 was synthesized as a codon-optimized construct (from Genscript) for expression in E ...
-
bioRxiv - Biophysics 2023Quote: ... DNA human WNK3 (118-409) was subcloned into a pET29b vector by Genscript Inc ...
-
bioRxiv - Molecular Biology 2023Quote: ... a plasmid with the human NSMCE2 cDNA was purchased from GenScript (cat # Ohu31586D). The NSMCE2 coding sequence was PCR-amplified to add a Kozak consensus sequence for efficient initiation of translation and flanking KpnI and XhoI restriction sites ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids expressing human KLF family proteins were purchased from Genscript (Piscataway, NJ) or OriGene (Rockville ...
-
bioRxiv - Biophysics 2023Quote: ... human/mouse codon-optimized genes coding for the identified ChRs were ordered (GenScript, Piscataway ...
-
bioRxiv - Cell Biology 2024Quote: ... the codon-optimized gene containing full-length human SNX27 was synthesized by GenScript® and cloned into pET28a vector as described previously (30) ...
-
bioRxiv - Molecular Biology 2019Quote: The human AQP7 gene (Uniprot ID O14520) was codon-optimized and synthesized from GenScript, China ...
-
bioRxiv - Biochemistry 2020Quote: The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC ...
-
bioRxiv - Cancer Biology 2022Quote: The cloning service of recombinant human HK1b and HK1c isoforms was performed by GenScript Inc (Piscataway ...