Labshake search
Citations for GenScript :
1 - 50 of 644 citations for Dog Trefoil Factor 3 TFF3 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... alpha-factor peptide (GenScript) was added to a final concentration of 5 µg/ml for 1.5 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... 10µL of α-factor (GenScript) was added to each well ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...
-
bioRxiv - Cell Biology 2022Quote: ... P-factor (TYADFLRAYQSWNTFVNPDRPNL) and α-factor (WHWLQLKPGQPMY) (Custom Peptide Synthesis, 4 mg, ≥95% purity, GenScript Biotech) were dissolved in DMSO to a concentration of 10 mM ...
-
bioRxiv - Biochemistry 2020Quote: ... the mating pheromone α-factor (GenScript) was added to log phase cultures grown to OD600 of 0.4–0.6 (MATa yeast strain BY4741 ...
-
bioRxiv - Cell Biology 2024Quote: ... α-factor was added to the cells to a final concentration of 5 ng/ml α-factor (GenScript RP01002) for 3 hours ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
bioRxiv - Neuroscience 2021Quote: ... granulocyte colony stimulating factor (G-CSF; GenScript, Piscataway, NJ) was dissolved in 0.9% sterile saline and administered intraperitoneally (IP).
-
bioRxiv - Neuroscience 2024Quote: ... 20 ng/mL Brain-derived neurotrophic factor (BDNF, GenScript), 20 ng/mL Glial Cell Line-derived Neurotrophic Factor (GDNF ...
-
bioRxiv - Biophysics 2022Quote: ... The target protein complexes were eluted twice with 500 μg/ml 3× DYKDDDDK peptide (RP21087, GenScript) dissolved in the wash buffer ...
-
bioRxiv - Immunology 2023Quote: ... and 10 ng/ml epidermal growth factor (GenScript; cat # Z00333). As keratinocytes attached more tightly to the dishes ...
-
bioRxiv - Biochemistry 2024Quote: ... and then arrested in G1 with alpha-factor (GenScript (RP01002)– 10 mg/ml stock concentration and 10 µg/ml working concentration ...
-
bioRxiv - Neuroscience 2020Quote: ... Rat granulocyte colony stimulating factor (G-CSF) was purchased from GenScript Corp (Piscataway NJ ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant human vascular endothelial growth factor-165 (VEGF) was from GenScript, and basic fibroblast growth factor (bFGF ...
-
bioRxiv - Neuroscience 2024Quote: ... 20 ng/mL Glial Cell Line-derived Neurotrophic Factor (GDNF, GenScript) in a 5% CO2 atmosphere at 37 °C ...
-
bioRxiv - Genetics 2022Quote: The HTP-3 antibody used in this study was generated from an identical C-terminal segment of the HTP-3 protein (synthesized by GenScript) as was used by (MacQueen et al ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... Cultures were blocked by addition of 5 μg/ml of α factor (GenScript) every 90 min in YPAD until <10% cells were budded ...
-
bioRxiv - Biochemistry 2020Quote: ... strains were arrested in G1 with 100 ng ml-1 alpha factor (GenScript) and incubation was continued for 3 hours ...
-
bioRxiv - Bioengineering 2023Quote: ... A DNA fragment for a floxed transcription stop transcription site (3 copies of SV40 late poly A sequence) followed by a H2B protein fused to mPlum was synthesized by Genscript (Piscataway, NJ) and inserted into pUC57-Kanamycin plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... The cultures were then synchronized at G1 using 10 μg/ml α-factor (GenScript) for 2-3 hours ...
-
bioRxiv - Genetics 2021Quote: ... Cultures were synchronized in G1 with 1.5 μg/ml alpha factor mating pheromone (GenScript) for 3 h at 30°C ...
-
bioRxiv - Cell Biology 2022Quote: ... MATα cells were verified by their lack of response to alpha factor (αF, Genscript) and by their ability to mate with MATa cells ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and recombinant human vascular endothelial growth factor-165 (VEGF) were from GenScript (Piscataway, NJ). Basic fibroblast growth factor (bFGF ...
-
bioRxiv - Neuroscience 2021Quote: ... cocaine (NIDA Drug Supply Program) or granulocyte colony stimulating factor (G-CSF; GenScript, Piscataway, NJ) was dissolved in artificial cerebrospinal fluid on the day of the experiment and applied to brain slices via bath perfusion ...
-
bioRxiv - Cell Biology 2024Quote: ... Serum-free medium containing 20 ng/ml platelet-derived growth factor-BB (PDGF-BB) (Z02892, GenScript) was used to trigger Erk1/2 activation ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Plant Biology 2024Quote: ... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
bioRxiv - Molecular Biology 2020Quote: Specific treatment conditions were as follows: GPCR activation – Cells were treated with α-factor peptide hormone (Genscript) at 3μM final concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... exponential cells growing in YPDA medium were synchronized with 15 μg/ml α-factor (GenScript Cat. No:RP01002) for 2h at 25 °C ...
-
bioRxiv - Biophysics 2024Quote: ... Protein was purified using Protein G resin (GenScript, L00209), concentrated to 2.5 mg/ml in TBS buffer ...
-
bioRxiv - Genetics 2024Quote: ... and bam 3’UTR by Genscript, Inc (Piscataway ...
-
bioRxiv - Molecular Biology 2024Quote: ... Recombinant ABE8.8 protein and SpRY-ABE8.8 protein were produced by GenScript. Duplicate ONE-seq experiments were previously performed for ABE8.8/PAH14 ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
Analysis of spike protein variants evolved in a novel mouse model of persistent SARS-CoV-2 infectionbioRxiv - Microbiology 2023Quote: Recombinant SARS-CoV-2 wild-type S protein RBD-HRP fusion protein (RBD-HRP protein, cat. no. Z03594) and hACE2 protein (cat. no. Z03516) were purchased from GenScript Korea Ltd ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Microbiology 2021Quote: ... and protein purification was performed with Protein A magnetic beads (GenScript, L00695). The purified mAbs were dialyzed against phosphate-buffered saline (PBS ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Genomics 2022Quote: ... G1 synchronization was achieved by incubating 700 ml of exponentially growing (OD600 0.2) bar1 cells with a final concentration of 5 ng/ml of alpha-factor (GenScript RP01002) for 3 hours ...
-
bioRxiv - Synthetic Biology 2024Quote: ... An elongation factor EF-P (GeneFrontier Corporation) and synthesized SKIK peptide dissolved in nuclease-free water (94.6% purity, GenScript, Tokyo) was added to achieve a final concentration of 1 µM and 100 µM ...
-
bioRxiv - Cell Biology 2023Quote: ... Adherent cells were then cultured with complete maturation media (RPMI-1640 with 10% FBS, penicillin/streptomycin, 10 ng/ml macrophage colony-stimulating factor (M-CSF) (Genscript) for 5 days for monocyte-derived macrophages (MDM ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated protein L (GenScript) and the addition of streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...