Labshake search
Citations for GenScript :
51 - 100 of 590 citations for Dengue Virus Serotype 3 DIII envelope protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... a linker region (DYDIPTT) and a Tobacco Etch Virus (TEV) protease site (ENLYFQG) in a pET-22b vector were purchased from Genscript. Site-directed mutagenesis was performed using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2021Quote: ... The codon-optimized gene encoding for these residues plus an engineered DNA sequence encoding for a C-terminal tobacco etch virus (TEV)-protease cleavage site (ENLYFQS) was synthesized by GenScript. This gene was then subcloned into the ampicillin-resistant ...
-
bioRxiv - Immunology 2020Quote: A full-length nucleocapsid (N) phosphoprotein nucleotide sequence (1293 base-pairs) of the SARS-CoV-2 virus was optimized and synthesized (Genscript). The synthesized sequence was cloned into a PET-30a(+ ...
-
bioRxiv - Immunology 2021Quote: Blocking of the RBD-ACE2 interaction by the mouse sera was assessed using a SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript) (Tan et al ...
-
bioRxiv - Immunology 2020Quote: ... A second serum aliquot was tested with a surrogate virus neutralization test that detects isotype-independent RBD neutralizing antibodies (cPass, GenScript) (18) ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized in pcc1-pbrick plasmid between cauliflower mosaic virus promoter (CaMV) 35S promoter and CaMV PolyA terminator de novo by GenScript, Piscataway ...
-
bioRxiv - Biochemistry 2023Quote: Remaining samples of sera from corresponding administration routes along with prebleed samples were pooled and passed through a protein A column and the recovered IgGs used in SARS-CoV-2 surrogate virus neutralisation assays (sVNT) 38 using a commercial kit (GenScript).
-
bioRxiv - Biochemistry 2024Quote: ... and synthesized and cloned into the pET-DUET-1 vector with a C-terminal Tobacco Etch Virus (TEV) protease cleavage site (ENLYFQG) and hexahistidine tag (His6) (GenScript). The expression construct was transfected into E ...
-
bioRxiv - Molecular Biology 2024Quote: ... or LV1-eGFP-miR-7 were generated by subcloning inserts from pAAV_hSYN1-eGFP-miR-7 and pAAV_hSYN1-eGFP (provided by Thomas B. Hansen) inside LV1 (immunodeficiency virus 1 (HIV-1)-based LV-PGK-GFP) backbone by GenScript Biotech Corporation ...
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Neutralizing antibodies against the SARS-CoV-2 in hamster blood plasma were determined using the “SARS-CoV-2 Surrogate Virus Neutralization test kit” (GenScript, USA).
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Molecular Biology 2019Quote: The NS1 sequence from ZIKV (Mexican isolate, Asiatic linkage) and YFV NS1 (Brazilian yellow fever virus isolate) were synthesized de novo (GenScript, Piscataway, NJ). The synthetic ZIKV NS1 gene (GenBank accession number KY631493.1 ...
-
bioRxiv - Microbiology 2020Quote: Detection and semi-quantitation of neutralizing antibodies was determined using SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript, Cat. No.: L00847). Testing of sera was performed as outlined in the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... the Thosea assigna virus (TAV) 2A protease and the mature IGIP was generated with a cloning spacer downstream and acquired from Genscript (Piscataway, NJ). The fragment was digested with AarI (Thermo Scientific ...
-
Analysis of spike protein variants evolved in a novel mouse model of persistent SARS-CoV-2 infectionbioRxiv - Microbiology 2023Quote: Recombinant SARS-CoV-2 wild-type S protein RBD-HRP fusion protein (RBD-HRP protein, cat. no. Z03594) and hACE2 protein (cat. no. Z03516) were purchased from GenScript Korea Ltd ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Microbiology 2021Quote: ... and protein purification was performed with Protein A magnetic beads (GenScript, L00695). The purified mAbs were dialyzed against phosphate-buffered saline (PBS ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated protein L (GenScript) and the addition of streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Microbiology 2019Quote: ... coli protein production (Genscript) and used as templates for subsequent cloning ...
-
bioRxiv - Molecular Biology 2023Quote: Serum samples were tested for presence of antibodies against SARS-CoV-2 with the L00847 surrogate virus neutralization test (sVNT) (GenScript cPass™, USA) as described in Mariën et al ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Plant Biology 2022Quote: Proteins were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and 4%-20% Precast Protein Plus Gel (Yeasen ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein G-Agarose beads (Genscript), Polyetheleneimine reagent (Polysciences ...
-
bioRxiv - Systems Biology 2021Quote: ... reinhardtii CDKB1 protein (Genscript, www.genescript.com)(64) ...
-
bioRxiv - Immunology 2020Quote: ... S1 and N proteins (Genscript) were conjugated onto MagPlex microsphere (Luminex ...
-
bioRxiv - Cancer Biology 2023Quote: ... biotinylated Protein L (GenScript USA) (25) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Bis-Tris Protein Gel (GenScript), and blotted ...
-
bioRxiv - Bioengineering 2023Quote: ... recombinant VZV gE protein (Genscript) diluted in coating buffer (Biolegend ...
-
bioRxiv - Plant Biology 2023Quote: Protein samples were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) or 10% SDS-PAGE gels and electrophoresed at 150 V for 2 h ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’-AATTCGGTCATGCCAGCGTA-3’) to target the mFoxO1gene and scrambled sgRNA (Sc-sgRNA) (5’-GCGAGGTATTCGGCTCCGCG-3’) were custom made by Genscript (Piscataway, NJ).
-
bioRxiv - Biochemistry 2021Quote: ... which contained an intact 3’UTR (GenScript, Piscataway, NJ). Two concentrations of Zfp36l1 (WT and mutant ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein ACE2-Fc (Genscript) at 5 μg/mL buffered in PBST (PBS with 0.02% Tween 20 ...
-
bioRxiv - Systems Biology 2021Quote: ... quadricauda predicted PGS protein (Genscript, www.genescript.com), and anti-Rubisco goat antiserum (diluted 1:3000 ...
-
bioRxiv - Biochemistry 2022Quote: ... And then Protein A beads (GenScript) were used to separate Fab fragments ...
-
bioRxiv - Immunology 2022Quote: ... and recombinant nucleocapsid protein (GenScript Z03488). The next day ...
-
bioRxiv - Immunology 2020Quote: ... and recombinant nucleocapsid protein (GenScript Z03488). The following day ...
-
bioRxiv - Immunology 2021Quote: ... and AmMag Protein A beads (Genscript) or loaded on a protein A (Cytiva ...