Labshake search
Citations for GenScript :
1 - 50 of 141 citations for Cow Melanocyte Stimulating Hormone Receptor MC1R ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and red pigment concentrating hormone (RPCH; GenScript) were prepared as 10−3 M aliquots (PROC and CCAP in distilled water ...
-
bioRxiv - Immunology 2023Quote: ... the commercialized ELISA kit (Genscript, Cat#L00871) was used ...
-
bioRxiv - Microbiology 2020Quote: ... intermedius competence stimulating peptide (DSRIRMGFDFSKLFGK, synthesized by Genscript) and incubated at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... intermedius competence stimulating peptide (DSRIRMGFDFSKLFGK, synthesized by Genscript) and incubated for 2 hours at the appropriate growth conditions (see above) ...
-
bioRxiv - Immunology 2021Quote: RBD and NP end-point titers were determined using standard ELISA and plates coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) or 1ug/mL SARS-CoV-2 nucleocapsid protein (NP) ...
-
bioRxiv - Immunology 2021Quote: RBD end-point titers were determined using standard ELISA and plates were coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) Heat inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... granulocyte colony stimulating factor (G-CSF; GenScript, Piscataway, NJ) was dissolved in 0.9% sterile saline and administered intraperitoneally (IP).
-
bioRxiv - Neuroscience 2020Quote: ... Rat granulocyte colony stimulating factor (G-CSF) was purchased from GenScript Corp (Piscataway NJ ...
-
bioRxiv - Bioengineering 2023Quote: ... Receptor candidate plasmids were purchased from GenScript. All selected ORF clones were introduced to a pcDNA3.1+/C-(K)-DYK backbone ...
-
bioRxiv - Molecular Biology 2020Quote: Specific treatment conditions were as follows: GPCR activation – Cells were treated with α-factor peptide hormone (Genscript) at 3μM final concentration ...
-
Dual targeting factors are required for LXG toxin export by the bacterial type VIIb secretion systembioRxiv - Microbiology 2022Quote: ... and supplemented with 5uL of 0.1mg/mL competence stimulating peptide (DSRIRMGFDFSKLFGK, synthesized by Genscript). Cultures were then incubated at 37°C and 5% CO2 without shaking for 45 minutes (GC1825 ...
-
bioRxiv - Immunology 2021Quote: Competitive inhibition ELISA was performed using SARS-CoV-2 neutralization antibody detection kit (Genscript). The kit detects circulating neutralizing antibodies against SARS-CoV-2 that block the interaction between the receptor binding domains of the viral spike glycoprotein (RBD ...
-
bioRxiv - Neuroscience 2021Quote: ... cocaine (NIDA Drug Supply Program) or granulocyte colony stimulating factor (G-CSF; GenScript, Piscataway, NJ) was dissolved in artificial cerebrospinal fluid on the day of the experiment and applied to brain slices via bath perfusion ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The His-tagged GMCSF peptide was quantified using a His Tag ELISA Detection Kit (GenScript) according to the provided protocol and 5-10 fold dilutions of frozen samples.
-
bioRxiv - Neuroscience 2019Quote: ... sapiens thyrotropin receptor (TSHR-FLAG) (Genscript USA Inc., Clone OHu18318D), H ...
-
bioRxiv - Molecular Biology 2023Quote: ... Sequence optimized cDNA encoding cytokines and receptors were purchased from GenScript. Primers and other sequence optimized cDNA were purchased from IDT and TWIST.
-
bioRxiv - Biochemistry 2020Quote: ... immunized animal sera were tested by indirect ELISA and competitive ELISA for immune response by GenScript. Western Blot evaluation of pre-sera and sera after 3rd immunization against 200 ng of purified protein/lane using a 1:1000 dilution was performed in-house as described ...
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of pseudovirus infection of cells containing SARS-CoV-2 receptors was performed on serum specimens using two commercially available SARS-CoV-2 LVV-PsN Kit (SC2087A; SC2087L; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... mutans cultures were diluted 1:40 from overnight cultures and grown to an optical density of OD600 ∼0.1 in THYE before the addition of transforming DNA and 1 μg ml−1 Competence Stimulating Peptide (CSP; GenScript). The cultures were subsequently incubated for an additional 2 h and then plated on antibiotic-supplemented THYE plates ...
-
bioRxiv - Microbiology 2019Quote: ... Transformation was performed essentially as described previously (72) with the competence stimulating peptide (CSP sequence: DLRGVPNPWGWIFGR) custom-synthesized by GenScript Inc ...
-
bioRxiv - Cell Biology 2023Quote: ... Adherent cells were then cultured with complete maturation media (RPMI-1640 with 10% FBS, penicillin/streptomycin, 10 ng/ml macrophage colony-stimulating factor (M-CSF) (Genscript) for 5 days for monocyte-derived macrophages (MDM ...
-
bioRxiv - Bioengineering 2023Quote: ... mAb was preferred for ELISA (GenScript, Cat.#A01854). For western blotting ...
-
bioRxiv - Cell Biology 2019Quote: IL-6 concentrations in the cell supernatant were were detected utilizing mouse IL -6 ELISA kit t (A015171517) purchased from GenScript Biological Technology Co.Ltd ...
-
bioRxiv - Biophysics 2022Quote: The receptor constructs including wild-type CCR5 and all phosphosite mutants were synthesized from GenScript and subcloned in pcDNA3.1(+ ...
-
bioRxiv - Synthetic Biology 2023Quote: The expression levels of his-tagged nanobodies resulting from microfermentations were quantified using the His tag ELISA detection kit (GenScript, Cat# L00436) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... and EphB1 panning (receptor antagonistic) peptide (EWLSPNLAPSVRGSGSK) and scrambled control peptide (RTVAHHGGLYHTNAEVK) were synthesized by GenScript. PCR primers were custom synthesized from Integrated DNA technologies ...
-
bioRxiv - Immunology 2021Quote: ... preliminary ELISA screening and production of hybridomas were performed by Genscript as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... and tested for affinity with ELISA and Western blot by Genscript.
-
ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signalingbioRxiv - Microbiology 2021Quote: ... sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1) subcloned into pLentiCRISPR v2 was purchased from GenScript (catalog # IFNAR1 crRNA 1 ...
-
bioRxiv - Immunology 2022Quote: ... KIR2DL3 stable HEK293F cell lines were established to evaluate the molecules recognizing the KIR receptors using pcDNA3.1 vectors (OHu24667C, OHu17046C, OHu55562C) (GenScript). The live cells were stained for NK and CD8+ T cell surface markers (anti-CD3 ...
-
bioRxiv - Immunology 2020Quote: ... and the S1-Receptor Binding Domain (S1-RBD; Cat. No Z03483; expressed in HEK293 cells) were purchased from by GenScript. The S1-N-terminal domain (S1-NTD ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were transiently transfected with plasmids containing receptors of interest under eukaryotic expression promoters (ASGR1 was clone OHU03658D from GenScript), then split into 96-well plates (20,000 cells per well ...
-
bioRxiv - Microbiology 2023Quote: Genes encoding His-tagged ectodomain versions of the HSV-1 gD receptors HVEM (HVEM200t) or nectin-1 (nectin345t) were synthesized by GenScript (GenBank accession numbers AF060231 and U70321 ...
-
bioRxiv - Cell Biology 2019Quote: ... Phospho-peptides conjugated to biotin for ELISA assay were synthesized by GenScript (Hong Kong). Antibodies against the IR β-subunit (sc-57342 ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Receptor was detected by primary rabbit anti-SNAP antibody (50 μL/well of 1:2000 dilution, GenScript, 1 h at RT) and anti-rabbit HRP antibody (50 μL/well of a 1:1000 dilution ...
-
bioRxiv - Immunology 2019Quote: 96-well ELISA plates were coated overnight at 4°C with mouse anti-Avi-tag antibody (Genscript) at 2 μg/ml in PBS ...
-
bioRxiv - Immunology 2021Quote: ... a commercial competitive ELISA SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) was used (Genscript, New Jersey, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... two stable sub-clonal cell lines of each parental clone were chosen for cryopreservation based on the result of ELISA (GenScript). Positive cell supernatants were evaluated by WB against 200 ng of purified protein/lane using a 1:10 dilution in-house as described ...
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Genomics 2023Quote: ... with CloneEZ PCR Cloning Kit (GenScript #L00339). The pLenti-GIII-EF1α-CBX3-Flag-HA ...
-
bioRxiv - Microbiology 2022Quote: The ToxinSensor Chromogenic LAL Endotoxin Assay kit (GenScript) was used to determine endotoxin units/mL of culture ...
-
bioRxiv - Neuroscience 2024Quote: ... a toxin Eraser endotoxin removal kit (#L00338, Genscript) with a high efficiency endotoxin removal resin was employed ...
-
bioRxiv - Neuroscience 2023Quote: ... using the High-Affinity Antibody Purification Kit (L00404, GenScript) following the manufacturer’s protocol.
-
bioRxiv - Bioengineering 2020Quote: ... and measured by ToxinSensor Chromogenic LAL Endotoxin Assay Kit (Genscript). The purified Nbs were further sterilized by passing a 0.2 μm filter (Millex ...
-
bioRxiv - Immunology 2020Quote: For the surrogate neutralization assay the cPass kit from GenScript was used (Cat ...