Labshake search
Citations for GenScript :
1 - 50 of 706 citations for Borrelia burgdorferi C p Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... burgdorferi dksA was commercially synthesized (GenScript, Piscataway, NJ, United States). The dksA gene was PCR amplified using primers listed in supplemental table 1 and cloned into the NheI site of the pMAL-C5X plasmid expression vector using a Gibson assembly kit (New England Biosciences ...
-
bioRxiv - Microbiology 2023Quote: Synthetic peptides of P covering the sequence N-EDDIYQLIM-C were obtained from GenScript. The peptide was dissolved in deionised water dosed with a drop of 5 M NH4OH to improve solubility ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag (clone HPC4, Genscript), anti-E tag (clone 10B11 ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.2 mg/mL Protein C peptide (Genscript) and 5 mM EDTA ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.2 mg/ml protein C peptide (Genscript), and 30 µM ‘8090.
-
bioRxiv - Biochemistry 2022Quote: ... 0.2 mg/ml protein C peptide (Genscript), and 30 µM ‘8090 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 0.5 mg/mL Protein C peptide (GenScript), and 100 nM SE001 ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag-171Yb (clone HPC4, Genscript), anti-mCherry-142Nd (Abcam) ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag-171Yb (clone HPC4, Genscript), anti-mCherry-142Nd (Abcam) ...
-
bioRxiv - Biochemistry 2020Quote: ... and 0.2 mg/mL Protein C peptide (Genscript), and concentrated on a Vivaspin 50-kDa concentrator.
-
bioRxiv - Microbiology 2023Quote: ... or rabbit anti-protein C (1:3000, GenScript) as primary antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-Protein C (mouse, Genscript, A01774, 1:1000), anti-α-tubulin (mouse ...
-
bioRxiv - Microbiology 2021Quote: The CAN97-83 HMPV N0-P construct with a 6X C-terminal His6-tag was synthesized by GenScript in the pET-29b(+ ...
-
bioRxiv - Biochemistry 2021Quote: LD membrane protein cDNAs in pcDNA3.1+/C-(k)DYK were purchased from GenScript and their variants with the OPG2 tag ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-p-CBX8 (Ser311) generated by Genscript.
-
bioRxiv - Cancer Biology 2021Quote: ... protein – NP_001058.2) cloned into pcDNA3.1+/C-(K)-DYK vector (Clone ID OHu21029D) was purchased from Genscript. The cDNAs were cloned into a bacterial expression vector ...
-
bioRxiv - Cell Biology 2020Quote: ... and the fragments with mutation of twenty prolines into glycines (P/G) or leucines (P/L) were synthesized by Genscript (USA) and inserted into pcDNA3 Flag-HA plasmid using BamHI and EcoRI restriction sites ...
-
bioRxiv - Biophysics 2022Quote: The C terminal domain of Influenza A Matrix protein 1 (M1C) was subcloned into pET15b vector (GenScript). In addition to the M1C sequence ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the C-terminal DYK sequence of the DNase1L3 protein coding sequence from the DNase1L3_OHu20141D_pcDNA3.1+/C-(K)-DYK plasmid (Genscript). The obtained sequence was then inserted into the pmEGFP-N1 vector to construct DNase1L3ΔNT-EGFP ...
-
bioRxiv - Biochemistry 2020Quote: ... rabbit anti-Hcp1 (P. aeruginosa) (diluted 1:5,000, Genscript) and detected with anti-rabbit horseradish peroxidase-conjugated secondary antibodies (diluted 1:5,000 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 10 µM P-factor (peptide-seq.: TYADFLRAYQSWNTFVNPDRPNL) (GenScript), DIX61 (MTNR1A ...
-
bioRxiv - Biophysics 2020Quote: The C-terminal sequence of the envelope protein (residues 41–75, [NH2]-AYCCNIVNVSLVKPSFYVYSRVKNLNSSRVPDLLV-[COOH]) was obtained from Genscript USA Inc. ...
-
bioRxiv - Cell Biology 2022Quote: ... The C-terminal BAP tag of localized mitosomal proteins was detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal marker GL50803_9296 was detected by a rabbit anti- GL50803_9296 polyclonal antibody (3) ...
-
bioRxiv - Bioengineering 2019Quote: ... then supplemented with 100 ng/ml sakacin P (SppIP) (Genscript). The cultures were allowed to grow overnight ...
-
bioRxiv - Biochemistry 2021Quote: ... gene was codon-optimized and cloned into the p423_GAL1 yeast expression vector as an N-terminal Flag (DYKDDDDK) and C-terminal decahistidine (10X His) tagged fusion protein (GenScript) (Fig ...
-
bioRxiv - Genetics 2022Quote: The HTP-3 antibody used in this study was generated from an identical C-terminal segment of the HTP-3 protein (synthesized by GenScript) as was used by (MacQueen et al ...
-
bioRxiv - Immunology 2021Quote: ... for >1 hour at ambient temperature then incubated with *** μg / protein gel of MonoRab anti-his tag C-term (Genscript) in Intercept T20 (PBS ...
-
bioRxiv - Molecular Biology 2023Quote: We chose gene fragments encoding complete deaminase domains as well as extra N and C protein sequences for commercial synthesis (GenScript) (fig ...
-
bioRxiv - Biochemistry 2024Quote: ... gene was codon-optimized and cloned into the p423_GAL1 yeast expression vector as an N-terminal Flag (DYKDDDDK) and C-terminal deca-histidine (10X His) tagged fusion protein (GenScript) (Supplementary Fig ...
-
bioRxiv - Cancer Biology 2021Quote: ... The custom polyclonal p-Smurf2Thr249 antibody was generated (#J1683BA260-5) (GenScript). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... Ppl and TerY-p systems were synthesized and cloned by Genscript Corp ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Microbiology 2020Quote: ... class C-like β-lactamase protein (gi|919167542) and the Elizabethkingia GOB-13 (AY647250) were synthesized by GenScript (Piscataway, NJ, USA) and optimized for protein expression in Escherichia coli in the pET24a(+ ...
-
bioRxiv - Biochemistry 2024Quote: ... Cell debris were removed by centrifugation (10,000 x g for 10 min at 4°C) and the supernatant was incubated with 30 μL of protein A/G-coated magnetic beads (Genscript L00277) for 1 hour at 4 °C to remove nonspecifically bound proteins ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were heated for 10 min at 100°C and were then loaded on an SDS gradient gel (4–20% Precast Protein Improve Gels, Genscript Biotech Corporation). The gel was run for 120 min at 120 V ...
-
bioRxiv - Cell Biology 2024Quote: ... and then subjected to denaturation at 100 °C for 10 min after the addition of 4X protein loading buffer (GenScript Biotech, China). Then ...
-
bioRxiv - Biochemistry 2020Quote: ... and a C-terminal TAMRA label (N-AAARKKRRQRRR-C, Genscript), and MerMade-synthesized unlabeled HIV-1 TAR ...
-
bioRxiv - Bioengineering 2024Quote: Genes encoding the designed protein sequence were synthesized and cloned into pET-24a(+) E.coli plasmid expression vectors (Genscript, C-terminal 6X His tag). Plasmids were then transformed into chemically competent BL21(DE3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibodies used were, anti-p-Smurf2Thr249 (#J1683BA260-5, 1:2000) (GenScript), anti-Phospho-Smad2 (Ser465/467 ...
-
bioRxiv - Microbiology 2020Quote: ... (2) the mScarlet gene (amplified from a P. falciparum codon-adjusted synthetic sequence (Genscript) (Fig ...
-
bioRxiv - Biochemistry 2023Quote: HeLa cells were lentiviral transduced with pLentiCRISPRv2 P-Rex1 guide RNA3 - AGGCATTCCTGCATCGCATC (Genscript SC1678). Forty-eight hours after transduction ...
-
bioRxiv - Cancer Biology 2022Quote: ... and c-Flag ERβ (OHu25562D; pcDNA3.1+/C-(K) DYK were obtained from GenScript.
-
bioRxiv - Immunology 2023Quote: ... Synthetic MOTS-c peptide (GenScript) was reconstituted in sterile water and used at 10 µM.
-
bioRxiv - Cell Biology 2022Quote: ... P-factor (TYADFLRAYQSWNTFVNPDRPNL) and α-factor (WHWLQLKPGQPMY) (Custom Peptide Synthesis, 4 mg, ≥95% purity, GenScript Biotech) were dissolved in DMSO to a concentration of 10 mM ...
-
bioRxiv - Cell Biology 2022Quote: ... or anti-c-Myc mAb (GenScript) were coupled with 50 µl beads and incubated with precleared proteins at 4°C for overnight with gentle mixing ...
-
bioRxiv - Cell Biology 2021Quote: ... Rabbit anti–c-Myc polyclonal (GenScript) and HRP-conjugated goat anti-rabbit antibody (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Microbiology 2023Quote: ... and C termini were synthesized (GenScript). Ligation-independent cloning following PCR amplification with appropriate primers and T4 DNA polymerase treatment was used to clone the sequences into pLIC6 ...
-
bioRxiv - Biochemistry 2020Quote: ... All P-Rex2 and PTEN mutations were synthesised and sequence-verified in the same vectors by Genscript. Rac1 (G12V ...
-
bioRxiv - Bioengineering 2023Quote: ... plantarum NCIMB8826 strain harboring helper plasmid pLH01 was induced with 100 ng/ml Sakain P peptide (GenScript) for RecE/T expression and was subsequently prepared as competent cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... to the N terminus of the DNase1L3 protein coding region and deleting the C-terminal DYK sequence from the DNase1L3_OHu20141D_pcDNA3.1+/C-(K)-DYK plasmid (Genscript), followed by insertion into the pmEGFP-N1 vector ...