Labshake search
Citations for GenScript :
251 - 300 of 698 citations for Anti FLAG M5 SAP Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Biophysics 2019Quote: ... His-tagged Xenopus laevis HAUS8 was used to produce rabbit polyclonal anti-HAUS8 anti-serum (Genscript). Alexa-647 labelled XenC antibody was generated by first dialyzing antibodies in PBS buffer (50mM NaPO4 ...
-
bioRxiv - Genomics 2022Quote: ... Anti-Sloth1 and Anti-Sloth2 antibodies (1:1000) were raised in rabbits (Genscript, PolyExpress Silver Package).
-
bioRxiv - Molecular Biology 2020Quote: ... anti-GFP (1:1000) (GenScript, A01704) anti-MRG-1 (1:1000 ...
-
bioRxiv - Plant Biology 2022Quote: ... rabbit anti-histone H3 (A01502, GenScript), and rabbit anti-PEPC (100-4163 ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-total H3 (GenScript, 2.5 µL), anti-H3K4me2 (Millipore 07-030 ...
-
bioRxiv - Microbiology 2020Quote: ... THE™ Anti-His-HRP (Genscript).
-
bioRxiv - Microbiology 2020Quote: ... mouse anti–β-actin (A00702, Genscript), or mouse anti-calnexin antibody (2433S ...
-
bioRxiv - Cell Biology 2022Quote: ... or anti-c-Myc mAb (GenScript) were coupled with 50 µl beads and incubated with precleared proteins at 4°C for overnight with gentle mixing ...
-
bioRxiv - Biochemistry 2020Quote: ... and G1 anti-DYKDDDDK resin (GenScript) were pre-washed 4x with the respective lysis buffer for each sample ...
-
bioRxiv - Molecular Biology 2019Quote: ... rabbit anti-RFP IgG (A00682, GenScript), mouse anti-PCNA IgG (Abcam ab29) ...
-
bioRxiv - Cell Biology 2021Quote: ... Rabbit anti–c-Myc polyclonal (GenScript) and HRP-conjugated goat anti-rabbit antibody (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-HPIV3 NP (GenScript, custom made against peptide ...
-
bioRxiv - Bioengineering 2022Quote: ... and biotinylated anti-STII (5A9F9, Genscript), followed by SAv-DyLight488 ...
-
bioRxiv - Bioengineering 2023Quote: ... and anti-VHH (A01860, GenScript, NJ) antibodies.
-
bioRxiv - Microbiology 2023Quote: ... An unconjugated Anti-HIS antibody (Genscript) was added (5.0 mg/mL ...
-
bioRxiv - Plant Biology 2023Quote: ... by using anti-myc (A00704, GenScript), anti-RFP (YH80520 ...
-
bioRxiv - Genomics 2023Quote: ... with CloneEZ PCR Cloning Kit (GenScript #L00339). The pLenti-GIII-EF1α-CBX3-Flag-HA ...
-
bioRxiv - Immunology 2023Quote: ... the commercialized ELISA kit (Genscript, Cat#L00871) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 1 ug of anti-UPF1 or anti-ARS2 antibodies and protein A/G magnetic beads (Genscript). The next day ...
-
bioRxiv - Developmental Biology 2020Quote: ... and rabbit polyclonal anti-pSer10 (GenScript, A00339). Secondary antibodies (with minimal species cross reactivity ...
-
bioRxiv - Bioengineering 2022Quote: ... A mouse anti-His-Tag antibody (GenScript) was diluted 1:100 and used as the primary antibody ...
-
bioRxiv - Molecular Biology 2020Quote: ... rabbit anti-V5 (GenScript, 1:500 dilution), rabbit anti-HA (Cell Signaling ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag (clone HPC4, Genscript), anti-E tag (clone 10B11 ...
-
bioRxiv - Immunology 2021Quote: ... anti-NWSHPQFEK (NWS) tag (clone 5A9F9, Genscript), anti-Ollas tag (clone L2 ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-Blimp1 (1:1000, GenScript, A01647). Retinas were washed PBS ...
-
bioRxiv - Microbiology 2021Quote: ... or anti-GST magnetic beads (Genscript, L00327). The beads were washed three to five times with ice-cold PBS and incubated with the cell lysates overnight at 4°C.The immunoprecipitates were washed three times in 1 ml SDS lysis buffer and subjected to immunoblot analysis ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti c-Myc (Genscript, 0.5 μg/mL); Anti EIF3B (Santa Cruz ...
-
bioRxiv - Microbiology 2022Quote: ... or rabbit anti-six histidine tag (Genscript, Nanjing ...
-
bioRxiv - Cell Biology 2022Quote: ... About 25 µg of anti-HA (GenScript) or anti-c-Myc mAb (GenScript ...
-
bioRxiv - Microbiology 2021Quote: ... Anti-Loqs antibody (custom generated by GenScript), Anti-HA antibody (ab130275 ...
-
Recruitment of MRE-11 to complex DNA damage is modulated by meiosis-specific chromosome organizationbioRxiv - Genetics 2020Quote: ... rabbit anti-OLLAS (1:1,000; Genscript #A01658), goat anti-SYP-1 (1:500) ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-p-CBX8 (Ser311) generated by Genscript.
-
bioRxiv - Cell Biology 2021Quote: ... Anti c-Myc (Genscript, 0.3 μg/mL), Anti VCP (Santa Cruz ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit polyclonal anti OLLAS (Genscript, 1:1500), rabbit polyclonal anti PAR (Trevigen ...
-
bioRxiv - Microbiology 2021Quote: ... and anti-RFP (1:3000 dilution, GenScript), anti-Dpm1 (1:3,000 dilution ...
-
bioRxiv - Biochemistry 2022Quote: ... and goat anti-Sch9 (GenScript, 1:1’000). To assess the loading ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-OLLAS 1:1000 (Genscript, A01658)) were added and incubated overnight in a humid chamber with a parafilm cover ...
-
bioRxiv - Microbiology 2022Quote: ... Anti-LISP2 antisera was generated by Genscript against the peptide NGQKGNVDEERKSM located between the repeat region and 6-Cys domain ...
-
bioRxiv - Microbiology 2023Quote: ... rabbit polyclonal anti-BiP (1:600, GenScript) serum ...
-
bioRxiv - Neuroscience 2023Quote: ... IP/Western blot antibodies were rabbit anti-Xenopus laevis CD2AP polyclonal affinity purified antibody raised against the peptide CRPKSEVEPHSKTKT custom made by GenScript and anti-Xenopus laevis FOLR1 antibody (GenScript). After washing steps ...
-
bioRxiv - Cell Biology 2023Quote: ... immunoblotted with antibodies (anti-GFP from Genscript, anti-DYKDDDK from Genscript ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-sera obtained from immunized rats (Genscript).
-
bioRxiv - Molecular Biology 2023Quote: ... and Anti-LmGAPDH (dilution 1:2,000 - GenScript), followed by incubation with Anti-rabbit IgG (dilution 1:50,000 - BioRad ...
-
CRISPR-Cas9 Engineered Extracellular Vesicles for the Treatment of Dominant Progressive Hearing LossbioRxiv - Bioengineering 2023Quote: ... anti-Cas9 antibody (Genscript, Cat# A01935, USA) 1% BSA mixture overnight at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... using anti-His (mouse) primary antibody (GenScript) at a dilution of 1:3,000 ...
-
bioRxiv - Cell Biology 2024Quote: ... rabbit anti-pS1133WRN (Genscript-custom, 1:10000); rabbit anti-GST (Calbiochem ...
-
bioRxiv - Microbiology 2022Quote: The ToxinSensor Chromogenic LAL Endotoxin Assay kit (GenScript) was used to determine endotoxin units/mL of culture ...
-
bioRxiv - Neuroscience 2024Quote: ... a toxin Eraser endotoxin removal kit (#L00338, Genscript) with a high efficiency endotoxin removal resin was employed ...