Labshake search
Citations for GenScript :
1 - 50 of 553 citations for Anti DBH SAP Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... immunoblotted with antibodies (anti-GFP from Genscript, anti-DYKDDDK from Genscript, anti-HA from Roche, anti-V5 from Genscript, HRP-linked ECL rabbit-IgG and mouse-IgG from Amersham ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Microbiology 2022Quote: ... or mouse anti-FLAG antibody (anti-DYKDDDDK antibody, Genscript) with Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2021Quote: ... anti-SpoVAD64 (1:10,000) and anti-His (1:4,000) (GenScript) antibodies ...
-
bioRxiv - Immunology 2020Quote: ... anti-S2 (SinoBiologicals #40590-D001) and anti-NC (Genscript #HC2003). Human and rhesus IgG antibodies were both detected in these calibration assays using biotinylated affinity-purified goat anti-human IgG γ chain polyclonal antibody (SBA #2048-08) ...
-
CASC3 promotes transcriptome-wide activation of nonsense-mediated decay by the exon junction complexbioRxiv - Molecular Biology 2020Quote: ... anti-EIF4A3 (Genscript), anti-FLAG (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2019Quote: ... Anti-Flag (GenScript), Anti-c-Myc (Invitrogen) ...
-
bioRxiv - Biochemistry 2022Quote: ... anti-GLTSCR1 (GenScript), anti-BRD9 (Bethyl ...
-
bioRxiv - Microbiology 2023Quote: ... anti-His6 (Genscript), and anti-σA (gift of David Rudner ...
-
bioRxiv - Immunology 2022Quote: ... 8) TCRβ-CD3εcrosslinking: mouse anti-V5 and rabbit anti-HA (Genscript); 9 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... anti-cGMP antibody (PerkinElmer anti-cGMP antibody: final dilution1:8000, Genscript anti-cGMP antibody ...
-
bioRxiv - Microbiology 2023Quote: ... Polyclonal anti-tapasin and anti-US10 were raised in rabbits (GenScript) using synthetic peptides (aa 418-428 and aa 54-67 ...
-
bioRxiv - Cell Biology 2023Quote: ... immunoblotted with antibodies (anti-GFP from Genscript, anti-DYKDDDK from Genscript, anti-HA from Roche ...
-
bioRxiv - Cancer Biology 2023Quote: Capture antibodies: affinity purified rabbit anti-L1 (anti-ORF1p or anti-ORF2p (RT fragment)) polyclonal antibodies were ordered from GenScript (Custom Polyclonal Antibody Production Service) ...
-
bioRxiv - Immunology 2022Quote: ... 4) TCRβ-CD3δ crosslinking: mouse anti-V5 and rabbit anti-FLAG (Genscript); 5 ...
-
bioRxiv - Immunology 2022Quote: ... 7) TCRβ-CD3ε crosslinking: rabbit anti-V5 and mouse anti-HA (Genscript); 8 ...
-
bioRxiv - Immunology 2022Quote: ... 2) TCRα-CD3δ crosslinking: rabbit anti-cMyc and mouse anti-FLAG (Genscript); 3 ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-SUMO (GenScript: A01693) and anti-GST (Abmart ...
-
bioRxiv - Biochemistry 2022Quote: ... anti-His tag (Genscript) or anti-FLAG (Genscript ...
-
bioRxiv - Biochemistry 2022Quote: ... or anti-FLAG (Genscript) antibodies ...
-
African Swine Fever Virus CD2v protein promotes β-Interferon expression and apoptosis in swine cellsbioRxiv - Microbiology 2020Quote: ... anti-Flag (A00187; Genscript) or anti-phosphorylated NF-κB (S536 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti Tbx20 (Genscript). Secondary antibodies were Alexa Fluor 488 goat anti-mouse IgG H+L (Thermo #A11001) ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-V5 from GenScript and anti-GFP from Santa Cruz Biotechnology ...
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Cell Biology 2020Quote: ... and Anti-PfAldolase Rabbit (GenScript) (marker for soluble fraction).
-
bioRxiv - Plant Biology 2020Quote: ... An anti-RFP (A00682, GenScript) was used as primary antibody overnight at 4ºC ...
-
bioRxiv - Immunology 2021Quote: ... anti-NP (GenScript, # A01506-40), anti-γ-H2AX (ABclonal ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-pT25 OsMKK1 antibody (GenScript), anti-ACT1 antibody (Beijing Protein Innovation) ...
-
bioRxiv - Biochemistry 2022Quote: ... anti-beta-ACTIN (GenScript A00702), anti-TOMM40 (Proteintech 18409-1-AP) ...
-
bioRxiv - Immunology 2022Quote: ... and mouse anti-V5 (Genscript); 2 ...
-
bioRxiv - Immunology 2022Quote: ... and rabbit anti-FLAG (Genscript); 4 ...
-
bioRxiv - Cell Biology 2022Quote: ... incubated with anti-GST (Genscript), anti-p44/42 MAPK (ERK1/2 ...
-
bioRxiv - Microbiology 2021Quote: ... Anti-His-HRP (Genscript, A00612), Avidin-HRP (Biolegend ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-GST (GenScript ; #A00865) and mouse anti-V5 (Life Technologies ...
-
African Swine Fever Virus CD2v protein promotes β-Interferon expression and apoptosis in swine cellsbioRxiv - Microbiology 2020Quote: ... or anti-Flag (A00187; Genscript) primary antibodies ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-His-HRP (Genscript, A00612), Avidin-HRP (Biolegend ...
-
bioRxiv - Biochemistry 2020Quote: ... goat anti-rabbit/HRP (Genscript) and rabbit anti-mouse/HRP (DAKO)-conjugated secondary were incubated with the blots to detect GBA2 (rabbit polyclonal antibodies ...
-
bioRxiv - Microbiology 2019Quote: ... Anti-FLAG antibody (GenScript #A00187) was incubated in 10% FBS and 1xPBS for 1 h at 37°C at a concentration of 1μg/mL ...
-
bioRxiv - Neuroscience 2020Quote: Goat polyclonal anti-GAPDH (GenScript), chicken polyclonal anti-MAP2 (EnCor Biotech ...
-
bioRxiv - Microbiology 2022Quote: ... or anti-streptavidin (STII GenScript rabbit anti-NWSHPQFEK polyclonal antibody ...
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-Myc-HRP (Genscript, A00863) and SYTOX™ Blue Dead Cell Stain (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... anti-His (1:4,000) (GenScript), anti-GFP (1:10,000 ...
-
bioRxiv - Plant Biology 2023Quote: ... anti-beta Actin [HRP] (GenScript), anti-DspE50 ...
-
bioRxiv - Biochemistry 2023Quote: ... immunoblotted with anti-DYKDDDK (Genscript) and Mouse IgG HRP-linked whole Ab (Cytiva) ...
-
bioRxiv - Biochemistry 2023Quote: ... and anti-V5 (A01724, Genscript) antibodies with the inputs loaded at 5 %.
-
bioRxiv - Synthetic Biology 2023Quote: ... Anti-streptag purified antibody (Genscript) was also APC conjugated ...
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...