Labshake search
Citations for GenScript :
1 - 50 of 202 citations for Adenovirus Type 5 Particles CMV β galatosidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The HA-tagged wild-type PITPα/β constructs and PI-binding deficient mutants T59D33 were purchased from Genscript. Constructs were transfected in mammalian cells by the lipid-based delivery system from Invitrogen (LipofectamineTM3000 ...
-
bioRxiv - Biochemistry 2023Quote: Human full-length wild-type DNA Pol β was overexpressed from a PET-28a codon optimized clone purchased from GenScript in the BL21-CodonPlus(DE3)-RP E ...
-
bioRxiv - Plant Biology 2023Quote: The constructs CMV::ACD6Col-0 and CMV::MHA1L were synthesized in pcDNA3.1 myc-6xHis or pcDNA3.1 mGFP5-6xHis (GenScript Biotech, NJ, USA). Two codon-optimized ACD6Col-0 sequences were obtained and synthesized from gBlock synthesis (GenScript ...
-
bioRxiv - Immunology 2023Quote: ... and cloned into the CMV/R vector (Barouch et al. 2005) by Genscript with a C-terminal hexahistidine affinity tag ...
-
bioRxiv - Cell Biology 2021Quote: FUS-CHOP type I and type II genes were synthesized by Genscript (Piscataway, NJ) and subcloned into pcDNA3-EGFP (Addgene 13031 ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti–β-actin (A00702, Genscript), or mouse anti-calnexin antibody (2433S ...
-
bioRxiv - Bioengineering 2023Quote: ... 13441-16236) was synthesized and inserted into the pcDNA vector with a CMV promoter by GenScript. To express the Rdrp in RPMI 1650 cell and in mice ...
-
Oral delivery of SARS-CoV-2 DNA vaccines using attenuated Salmonella typhimurium as a carrier in ratbioRxiv - Microbiology 2020Quote: The pcDNA3.1(+)-CMV-SARS-CoV-2-S-GFP (pSARS-CoV-2-S) plasmid was purchased from Genscript Co. ...
-
bioRxiv - Neuroscience 2023Quote: The wild-type construct was synthesized by Genscript Biotech by adding eGPF (accession JN204884.1) ...
-
bioRxiv - Cancer Biology 2024Quote: ... rabbit polyclonal β-catenin(A01211-40; Genscript, China), rabbit polyclonal YAP1(A1002 ...
-
bioRxiv - Immunology 2023Quote: Antibody heavy chain and light chain genes were synthesized and cloned into plasmids containing the CMV promoter (GenScript). Final heavy and light chain plasmids were amplified ...
-
bioRxiv - Genomics 2023Quote: ... plasmids containing wild type ORFs were obtained from GenScript. The ORFs were cloned into the pcDNA3.1(- ...
-
bioRxiv - Immunology 2022Quote: ... or TN peptide (β-hex peptide sequence YKGSRVWLN - GenScript)27 was added to the wells ...
-
bioRxiv - Molecular Biology 2022Quote: ... Full-length mouse IMPG1 variants were synthesized and inserted in a pcDNA3.1(+)-P2A-eGFP vector under a CMV promotor by Genscript. All IMPG1 proteins were expressed in HEK293 cells ...
-
bioRxiv - Immunology 2023Quote: ... Lentiviral particles for spike transduction were generated by transfecting 293T cells with pMD2.G (Genscript), psPAX2 (Genscript ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The wild type AAV9 capsid gene sequence was synthesized (GenScript) with nucleotide changes at S448 (TCA to TCT ...
-
bioRxiv - Biophysics 2023Quote: ... and αS ΔNAC: Wild-type plasmids were synthesized from Genscript ® and the rest of the constructs were cloned at Florida State University ...
-
bioRxiv - Cell Biology 2021Quote: ... which was synthesized to contain 7 modified TetO elements flanked by two minimal CMV promoter sequences based on pTet-T2 sequences (GenScript) (49) ...
-
bioRxiv - Cell Biology 2022Quote: ... the mAp-PFN1 cassette was synthesized and inserted into pmApple-C1 behind the CMV promoter at the Ndel and BamHI restriction sites (Genscript). The amino acid linker and PFN1 was synthesized into the backbone of a pcDNA-Halo expression vector (provided by Gunther Hollopeter ...
-
bioRxiv - Microbiology 2022Quote: ... a gene SIRT7 (C-terminally 3xFLAG tagged) under the control of a CMV promoter in pcDNA3.1 was commercially synthesized (GenScript, USA). For transfection experiments ...
-
bioRxiv - Immunology 2020Quote: ... Genes for expression of HA fusions to nanoparticle trimeric components were codon optimized for expression in human cells and cloned into the CMV/R (VRC 8400) mammalian expression vector by Genscript. All HA fusions to the I53_dn5B trimer contained full-length HA ectodomains including native secretion signals ...
-
bioRxiv - Molecular Biology 2021Quote: ... Variants of CMV-ubi-nsP4-RRV and CMV-ubi-nsP4-SINV containing mutations listed in supplementary figure S6 were constructed using synthetic DNA fragments (Genscript). Sequences of all plasmids were verified using Sanger sequencing and are available from the authors upon request.
-
bioRxiv - Synthetic Biology 2022Quote: ... This gene was codon optimized for human cell expression and made in the CMV/R mammalian expression vector by Genscript. Transient transfection into HEK293F cells was carried out using PEI MAX ...
-
bioRxiv - Biochemistry 2022Quote: ... and subsequently cloned into pLenti-CMV-MCS-GFP-SV-puro using XbaI and BamHI to replace GFP or cloned directly into pLenti-CMV-MCS-GFP-SV-puro by Genscript using the same sites ...
-
bioRxiv - Immunology 2023Quote: ... and were codon-optimized for human cell expression and made in the CMV/R vector (Barouch et al. 2005) by Genscript with a C-terminal hexahistidine affinity tag ...
-
bioRxiv - Biochemistry 2024Quote: ... fused to consecutive C-terminal HA (hemagglutinin)- and FLAG-tags and cloned into pCDNA-3.1 plasmid for expression in HEK293 cells by the CMV (cytomegalovirus) promoter (GenScript Biotech). Mutant variants were generated by site directed mutagenesis (GenScript Biotech).
-
bioRxiv - Cell Biology 2024Quote: cDNA encoding native integrin α and β-subunits from Genscript (gene and accession No ...
-
bioRxiv - Cell Biology 2020Quote: ... AAV production protocols were modified to include polyethylenimine co-transfection of an AAP-6 expression plasmid (ORF under the control of the CMV promoter, synthesized by GenScript Biotech), the variant 5 AAV cap plasmid ...
-
bioRxiv - Biochemistry 2022Quote: ... laevis GST-importin-α and GST-importin-β generated by GenScript and purified from serum according to previously published protocols (Alfaro-Aco et al. ...
-
bioRxiv - Immunology 2023Quote: CPG2 and β-Lac proteins were produced and purified by GenScript as previously described (7) ...
-
bioRxiv - Physiology 2023Quote: ... expression plasmid consisting of a cytomegalovirus (CMV) promoter/enhancer and SV40 poly-A region flanked by AAV2 terminal repeats (pAAV2) by Genscript (Piscataway, USA) described previously38 ...
-
bioRxiv - Microbiology 2019Quote: ... PRV Us9 wild-type and mutant genes were synthesized (Genscript, Piscataway, NJ). The cellular gene Kif1A was PCR amplified from rat cDNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... wild-type and mutated deiChO-262 fragments were synthesized by GenScript (USA) and cloned into the reporter constructs placZattB (Table S4) ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Microbiology 2021Quote: The synthetic gene encoding the BT_1526 ORF (wild type) was ordered from Genscript cloned into a pET-28a expression plasmid with a six-histidine tag at the N-terminus ...
-
bioRxiv - Microbiology 2023Quote: Sequential site-directed mutagenesis was performed using wild-type ALKBH1 plasmid (OHu05179, GenScript) as a template with the following primer pairs ...
-
bioRxiv - Biochemistry 2022Quote: The β-barrel (amino acid 21 to 323) subdomain was produced by Genscript Biotech ...
-
bioRxiv - Immunology 2022Quote: ... 55 μM β-mercaptoethanol) supplemented with 20 μg/mL MOG35-55 peptide (GenScript), 20 ng/mL IL-12 (Biolegend) ...
-
bioRxiv - Biochemistry 2022Quote: The wild-type bovine MRP4 gene and the MRP4E1202Q mutant were synthesized by Genscript and cloned into pFastBac with a C-terminal thrombin-cleavable 8xHis tag ...
-
bioRxiv - Microbiology 2019Quote: ... murine IL-12α and β genes (Uniport no. P43432) [17] were also synthesized (GenScript) and cloned into pSFTSV (pSFTSV-IL-12 ...
-
bioRxiv - Biophysics 2022Quote: The receptor constructs including wild-type CCR5 and all phosphosite mutants were synthesized from GenScript and subcloned in pcDNA3.1(+ ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Human C-type natriuretic peptide (CNP) and rat atrial natriuretic peptide (ANP) were from GenScript Corp ...
-
bioRxiv - Biophysics 2023Quote: ... The gene encoding the wild-type hSOD1 of the native sequence was purchased from Genscript with E ...
-
PHF2 regulates homology-directed DNA repair by controlling the resection of DNA double strand breaksbioRxiv - Molecular Biology 2019Quote: Antibodies obtained from commercial sources were as following: β-actin and Histone H3 from Genscript, Ku86 (C-20 ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Biochemistry 2021Quote: Wild-type USP14 and mutants were cloned into pGEX-4T vector obtained from GenScript (Nanjing, China). For purification of recombinant USP14 and mutants ...
-
bioRxiv - Biochemistry 2021Quote: ... The wild-type protein and the mutant K96A cloned in pET28a vector were ordered from GenScript. The N-terminally truncated constructs were cloned by amplifying the sequence from the original vector and subcloning into BsaI-cleaved plasmid pNIC28_Bsa4 by SLiCE cloning (83) ...
-
bioRxiv - Cell Biology 2023Quote: ... accession number XM_006514830.3) and type 3 (transcript variant 1, accession number NM_001363282.1) was purchased from GenScript (Clone IDs OMu45282 and OMu45285 ...