Labshake search
Citations for GenScript :
1 - 50 of 936 citations for Acetamide N 5 bis 2 hydroxyethyl amino 2 2 chloro 4 6 dinitrophenyl azo 4 methoxyphenyl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Bioengineering 2024Quote: ... or 4 μg BMP-2 (Genscript, Piscataway, NJ) per mg GMs ...
-
bioRxiv - Bioengineering 2024Quote: ... hydrogels of varying Young’s modulus: 5 kPa (4% 20 kDa 4-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript), 12 kPa (5% 40 kDa 8-arm PEG-NB ...
-
bioRxiv - Microbiology 2024Quote: ... Peptide cleavage reporter assays were prepared by combining 1 µL of PsCaspase cell lysates with 2 µL of 100 µM synthetic 7-amino-4-methylcoumarin (AMC)-conjugated peptides (Genscript) and 5 µL of 100 mM sodium phosphate buffer (pH 7.4 ...
-
bioRxiv - Microbiology 2022Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Microbiology 2023Quote: ... BA.2 and BA.4/5 lacking the C-terminal 19 codons (SΔ19) was synthesized by GenScript. The SΔ19 gene of BA.2.75 ...
-
CRISPR-based environmental biosurveillance assisted via artificial intelligence design of guide-RNAsbioRxiv - Molecular Biology 2024Quote: ... 4 µL of 5X optimized Cas13a reaction buffer (see Supplemental Table 6) or 2 µL 10X Cas13a reaction buffer (GenScript, #Z03486), 0.5 µL of Murine RNAse inhibitor (New England Biolabs - NEB ...
-
bioRxiv - Immunology 2021Quote: ... Peptide pools consisted of 15-mer peptides overlapping by 11 amino acids and spanned the entire S and N proteins of SARS-CoV-2 (GenScript). After stimulation ...
-
bioRxiv - Immunology 2022Quote: ... Peptide pools consisted of 15-mer peptides overlapped by 11 amino acids and spanning the entire S and N proteins of SARS-CoV-2 (GenScript). After stimulation ...
-
bioRxiv - Immunology 2021Quote: Biotinylated SARS-CoV-2 S1 protein and biotinylated SARS-CoV-2 N protein were purchased from GenScript. The biotinylated proteins were combined with different streptavidin (SA ...
-
bioRxiv - Microbiology 2021Quote: ... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 N and S1 proteins were obtained from Genscript and Sino Biological.
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Microbiology 2024Quote: ... followed by staining of cells with primary rabbit anti-SARS-CoV-2 N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Biophysics 2024Quote: The sequence expressing SARS-CoV-2 N protein was obtained from Genscript inside Pet-28 plasmid ...
-
bioRxiv - Biochemistry 2022Quote: ... YedK peptide consisting of the amino acids 2-16 (CGRFAQSQTREDYLA) was synthesized by Genscript. 50 nM 5’-FAM-labeled AP-DNA (FAM_U_20 ...
-
bioRxiv - Immunology 2024Quote: ... custom 15mer OLPs with 11 amino acid overlap were generated spanning the SARS-CoV-2 Spike RBD WH-01 protein (amino acids R319-S591, GenScript). WH-01 peptides that contained VOC mutation loci were substituted with the corresponding mutant sequences when applicable ...
-
bioRxiv - Immunology 2020Quote: ... derived from a peptide scan [15-mers with 11 amino acid overlap] through Spike glycoprotein of SARS-CoV-2) (JPT, Cat: PM-WCPV-5 or GenScript, Cat: RP30020). Phorbol Myristate Acetate (PMA ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Biophysics 2020Quote: ... and then resolved on 4%-20% Bis-Tris gels (GenScript). The gels were stained with Coomassie brilliant blue and imaged with Image Lab 3.0 (Bio-Rad).
-
bioRxiv - Biochemistry 2024Quote: ... SDS-PAGE (SurePAGE™, Bis-Tris, 10ξ8, 4-12%, GenScript) was used to assess protein purity ...
-
bioRxiv - Microbiology 2024Quote: Samples were separated on 4-12% Bis-Tris gels (Genscript) in Tris-MOPS-SDS running buffer (Genscript M00138 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a portion was taken for replating (2×10^4 cells per replicate) with human (GenScript Z03034-50) or mouse (GenScript Z02767-10 ...
-
bioRxiv - Cell Biology 2024Quote: ... were separated via SDS-PAGE using 4-12% Bis-Tris (Genscript) in 1X MES Running Buffer (Genscript ...
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Microbiology 2021Quote: ... Specific anti-CoV immunoreactivity was detected using an in-house SARS-CoV-2 nucleocapsid protein (U864YFA140-4/CB2093) rabbit antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Biochemistry 2021Quote: ... To elute the OST complex the beads were incubated for 2 hrs at 4 °C with purification buffer enriched with 0.5 mg/mL 1D4 peptide (GenScript Corp.). The flow-through was collected in a 100 kDa cutoff filter column (Amicon Centrifugal Filter Device) ...
-
bioRxiv - Cancer Biology 2024Quote: Gene blocks containing three fragments of the long isoform of NAB2-STAT6 (exons 1-4 of NAB2 and exons 2-22 of STAT6) with a c-terminal FLAG tag were ordered from GenScript. Using Gibson Assembly® Master Mix (NEB ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Plates were coated ON at 4 °C with 2 µg/mL mouse anti-human IgG Fc (Genscript, Piscataway, NJ, USA) in PBS ...
-
bioRxiv - Biochemistry 2024Quote: ... non-targeting sgRNA (TGCTTTACCGCGTTGGGTAA) or CLYBL targeting sgRNA (exon 2: CATAGAGCACTGCTCTCCGG; exon 3: AGACTTTGACCTGGGCACAA; exon 4: CCATTGCAGTCTCCACAAAG) were purchased from Genscript. Plasmids were transformed into OneShot™ E ...
-
bioRxiv - Cell Biology 2020Quote: ... and resolved on a 4-12% Bis-Tris polyacrylamide gradient gel (Genscript). Proteins were transferred to PVDF membranes and immunodetection of respiratory chain complexes was performed using the Total OXPHOS Blue Native WB Antibody Cocktail (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... Using SurePAGE 4-12% bis-tris gels (GenScript, Piscataway, NJ; cat # M00653), 40μl of protein sample was loaded into each well and run at 200V for roughly 1.5 hours in Tris-MOPS-SDS running buffer (GenScript ...
-
bioRxiv - Biochemistry 2022Quote: ... using SurePAGE 4-20% gradient Bis-Tris gels (Genscript, Picastaway, NJ, USA) under reducing conditions ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were loaded on Bis-Tris gradient gels (4-20%, Genscript) and run using Tris-MOPS buffer at 60 mA/200 V ...
-
bioRxiv - Biochemistry 2024Quote: ... The reaction was stopped at different time points by adding Laemmli sample buffer and incubating the samples 5 min at 95 °C before loading them on Bis-Tris-SDS 4-20% polyacrylamide gels (SurePAGE, GenScript).
-
bioRxiv - Neuroscience 2024Quote: ... denatured for 5 min at 95°C and electrophoresed on a 4-12% Bis-Tris Sure PAGE (GenScript, Piscataway, NJ) with the molecular weight marker (Prime-Step Prestained ...
-
bioRxiv - Immunology 2023Quote: ... The full-length BQ.1.1 S construct containing a 21 amino acid C-terminal deletion was generated by mutagenesis of the BA.4/5 S construct by Genscript.
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Cell Biology 2024Quote: ... Equal amount of total protein (typically 20 or 30 µg/sample) were separated either on 4-12% or 4-20% SurePAGE Bis-Tris gels (Genscript) and transferred on nitrocellulose membrane (Merck Millipore ...
-
bioRxiv - Neuroscience 2024Quote: ... and FAT-2 (Genscript) cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The lysate was heated at 95°C for 5 min and centrifuged at 10000 rpm/s for 2 min to remove the insoluble material prior to SDS-PAGE in a 4-20% gradient ExpressPlus™ PAGE Gels (Genscript) at constant 120 V for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 million cells/well were added into a 6-well plate and cultured with 2 mL RPMI-1640 medium/well (10 ng/mL IL-4, and 20 ng/mL mGM-CSF, GenScript, China) to obtain BMDCs at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2022Quote: ... A total of 500,000 splenocytes were restimulated ex vivo with the full-length SARS-CoV-2 B.1.1.529 S 15-mer (overlapping by 11 amino acids) peptide pool (GenScript) in plates pre-coated with anti-IFN-γ or anti-IL-4 antibodies ...
-
bioRxiv - Immunology 2021Quote: 15-mer peptides that are overlapping by 10 amino acids (AA) spanning the entire SARS-CoV-2 Spike protein (GISAID EPI_ISL_410713) were synthesized (Genscript) and pooled into 7 pools of approximately 40 peptides in each pool (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2021Quote: The ability of aptamers to block the association of SARS-COV-2 RBD with ACE-2 was measured with the cPass™ SARS-CoV-2 Neutralization Antibody Detection kit (GenScript®). For comparison ...
-
bioRxiv - Biochemistry 2024Quote: ... The reaction mixture was resolved on a 4-20% Bis-Tris gel (Genscript) and visualized by Coomassie staining.
-
bioRxiv - Biochemistry 2020Quote: SARS-CoV-2 nsp12 gene (amino acid 4393-5324 Uniprot: P0DTD1) was synthesized de novo by GenScript (Nanjing, China) and constructed onto pET22b vector between NdeI and XhoI sites ...