Labshake search
Citations for GenScript :
1 - 50 of 481 citations for 8 8 dimethylpyrano 2 3 h chromen 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... 6 and 8 were analyzed with the cPass™ SARS-CoV- 2 neutralization antibody detection kit (GenScript, Cat #L00847) to detect any antibodies that neutralize the interaction between the RBDdelta and the ACE2 receptor ...
-
bioRxiv - Developmental Biology 2024Quote: ... 8% surePAGE gels (GenScript) were used for electrophoresis and Immobilon-FL PVDF membranes (Millipore ...
-
bioRxiv - Biophysics 2021Quote: ... CCKAR–G protein complexes were assembled at room temperature (RT) for 1 h by the addition of 10 μM CCK-8 (GenScript) and 25 mU/mL apyrase ...
-
bioRxiv - Immunology 2019Quote: ... B10.RIII mice (female, 6 to 8 weeks old, n = 8) were immunized with 100 μg IRBP160-181 peptide (GenScript, Piscataway, N.J.) dissolved 100 μl PBS emulsified in 100 μl of complete Freund’s adjuvant ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Neuroscience 2019Quote: ... LEC-13-8 and minimal promoters were synthesised by Genscript, USA ...
-
bioRxiv - Microbiology 2021Quote: Samples were loaded on an 8% SDS-Page gel (Genscript) with 4×106 infected RBCs or 50 μg protein for the parasite lysate approach ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 8 kb p5343 was synthesized by Genscript (Piscataway, NJ). To propagate the synthesized DNA in the model bacterium E ...
-
bioRxiv - Immunology 2022Quote: ... 8) TCRβ-CD3εcrosslinking: mouse anti-V5 and rabbit anti-HA (Genscript); 9 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Peak fractions were resolved on 8–16% SurePAGE Bis-Tris (GenScript) gels.
-
bioRxiv - Cell Biology 2023Quote: ... or SurePAGE™ Bis-Tris 8% mini gel (GenScript, Cat. #M00662), using MES-SDS running buffer (GenScript Cat ...
-
bioRxiv - Neuroscience 2024Quote: ... 8 µg of protein was loaded onto a 10% SurePAGE polyacrylamide gel (Genscript) and resolved for 1 cm ...
-
bioRxiv - Genetics 2023Quote: ... The Klf2 genomic fragment from intron 2 to the exon 3 untranslated region was synthesized (GenScript) and cloned into the HindIII-SbfI site of pPGKneo-F2F-Klf2-5HR located at the opposite side of the NotI site with respect to the neo cassette ...
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was collected and incubated for 1 h with 2 ml of 50% slurry of Glutathione Resin (Genscript) before loading onto an empty EconoPac gravity-flow column (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Biophysics 2024Quote: Macroscopic potassium currents (whole-cell currents) were recorded 2-3 days after injection of hKir2.1 cDNA (Genscript) using a two-electrode voltage-clamp amplifier (OC-725C ...
-
bioRxiv - Cell Biology 2020Quote: ... Purified TopBP1b6-8 WT and W1145R were digested with PreScission 3C enzyme (GenScript, Z03092-500) for 3h at 16°C to remove the 6-His and MBP tag before phase separation in reaction mixtures in buffer C containing 10μM of WT or W1145R TopBP1b6-8-GFP and 2% of PEG4000 (Merck-Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... The repair templates (for Nup54-mEGFP(0) and Nup133- mEGFP(-8) were synthesized by GenScript as dsDNA ...
-
bioRxiv - Neuroscience 2023Quote: New World monkey oxytocin (Pro-8 oxytocin 75) was custom synthesized (GenScript, Piscataway, NJ, USA) and was dissolved in 0.5 mg/mL of 0.9% NaCl solution ...
-
bioRxiv - Molecular Biology 2023Quote: The synthetic peptides containing the 8-residue long LC8 binding motifs were ordered from Genscript Ltd ...
-
bioRxiv - Neuroscience 2024Quote: ... and FAT-2 (Genscript) cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Biochemistry 2022Quote: ... The plasmids containing the L245A and L245C substitutions in gene 8 were also made by GenScript. The constructs ...
-
bioRxiv - Microbiology 2021Quote: The ability of aptamers to block the association of SARS-COV-2 RBD with ACE-2 was measured with the cPass™ SARS-CoV-2 Neutralization Antibody Detection kit (GenScript®). For comparison ...
-
bioRxiv - Molecular Biology 2019Quote: ... Readthrough product of rab6 (Figure 1e) was detected using rabbit anti-Rab6 3’UTR antibody (2 μg/ml, GenScript) and revealed with Clean-Blot IP Detection Reagent (Thermo Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... SARS-CoV-2 pseudovirus (Genscript) was diluted in DMEM complete media to an IFU of 3.2e7/mL ...
-
bioRxiv - Microbiology 2021Quote: ... ACE-2 –Fc (GenScript Z033484) was diluted at 1.2µg/ml in HBS P+ (Cytiva ...
-
bioRxiv - Developmental Biology 2021Quote: ... Proteins were run on gradient pre-cast SDS polyacrylamide gels (8-16%, ExpressPlu, GenScript, M81610, Piscataway, USA) before being transferred to nitrocellulose membranes (0.45μm ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were run on precast SurePAGE gels (Bis–Tris, 10×8, 4%– 12%, 15 wells; GenScript) and transferred to polyvinylidene difluoride membranes (Beyotime Biotechnology ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Neuroscience 2019Quote: ... Samples were heated to 95°C for 5 min and resolved on 8-16% Bis-Tris gels (Genscript) before being transferred to PVDF membranes using the Iblot2 Dry blotting system (ThermoFishcer) ...
-
bioRxiv - Biochemistry 2022Quote: Gene 8 was synthesized and cloned into pet45b using the KpnI and BamHI sites by GenScript (Piscataway, NJ). The plasmids containing the L245A and L245C substitutions in gene 8 were also made by GenScript ...
-
bioRxiv - Biophysics 2020Quote: ... Region +95 to +374 containing (linker-Spinach 2-linker-Spinach 2-linker) was synthesized by GenScript as double stranded DNA delivered on a pUC57 plasmid ...
-
bioRxiv - Systems Biology 2021Quote: ... and 2 were synthesized by Genscript. RTKs were cloned into MAC-TAG-C expression vector (Liu et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Angiopep-2 was obtained from GenScript. Puromycin dihydrochloride ...
-
bioRxiv - Immunology 2020Quote: ... Pseudotyped SARS-CoV-2-S (Genscript), full-length recombinant S protein (Acrobio systems) ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Immunology 2021Quote: Biotinylated SARS-CoV-2 S1 protein and biotinylated SARS-CoV-2 N protein were purchased from GenScript. The biotinylated proteins were combined with different streptavidin (SA ...
-
Oral delivery of SARS-CoV-2 DNA vaccines using attenuated Salmonella typhimurium as a carrier in ratbioRxiv - Microbiology 2020Quote: The pcDNA3.1(+)-CMV-SARS-CoV-2-S-GFP (pSARS-CoV-2-S) plasmid was purchased from Genscript Co. ...
-
bioRxiv - Microbiology 2022Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Immunology 2022Quote: EAE was induced by immunization of 8-12 week-old mice with 200 μg of MOG35-55 peptide (GenScript) emulsified in complete Freund’s Adjuvant (400 μg desiccated Mycobacterium tuberculosis H37 Ra mixed with incomplete Freund’s adjuvant (BD Biosciences)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... were designed using the p100pop consensus sequence (accession number KC595609.1, [8]. The sequences were commercially synthesized and cloned into a pUC57 vector (GenScript). The plasmid p100NGS_coding_FLAG_PS (accession number OQ726015 ...
-
bioRxiv - Biochemistry 2021Quote: BiP-binding sites 1 and 3 were synthesized by Alan Scientific (Gaithersburg, MD) and site 2 was synthesized by Genscript (Piscataway, NJ). All peptides are N-terminally labeled with FITC via an amino hexanoic acid linker ...
-
bioRxiv - Microbiology 2022Quote: ... The vectors expressing the Omicron SARS-CoV-2-spike (S1+S2)-long (B.1.1.529) and SARS-CoV-2-spike (S1+S2)-long (B.1.1.529 sublineage BA.2) were obtained from GenScript and Sino Biological ...
-
bioRxiv - Microbiology 2022Quote: ... The vectors expressing the Omicron SARS-CoV-2-spike (S1+S2)-long (B.1.1.529) and SARS-CoV-2-spike (S1+S2)-long (B.1.1.529 sublineage BA.2) were obtained from GenScript and Sino Biological ...
-
bioRxiv - Microbiology 2023Quote: ... Human MARCH2 isoform 2 was identified from https://www.uniprot.org/uniprotkb/Q9P0N8/entry#Q9P0N8-1/2 and was acquired from GenScript, (clone ID ...
-
bioRxiv - Biochemistry 2020Quote: 2 µg GST (GenScript; Cat. # Z02039-1), ubiquitin (R&D Systems ...
-
bioRxiv - Immunology 2019Quote: ... KHNYN-2 (NM_001290256) was synthesized by GenScript. KHNYN-1 was cloned by amplifying the nucleotides 123-2157 from KHNYN-2 and sub-cloning the PCR product into the pcDNA3.1 (+ ...